Mu Opioid Receptor (OPRM1) (NM_001285528) Human Untagged Clone

CAT#: SC335282

OPRM1 (untagged) - Human opioid receptor, mu 1 (OPRM1), transcript variant MOR-3


  "NM_001285528" in other vectors (1)

Reconstitution Protocol

USD 320.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "OPRM1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol OPRM1
Synonyms LMOR; M-OR-1; MOP; MOR; MOR1; OPRM
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001285528, the custom clone sequence may differ by one or more nucleotides


ATGAAGACTGCCACCAACATCTACATTTTCAACCTTGCTCTGGCAGATGCCTTAGCCACCAGTACCCTGC
CCTTCCAGAGTGTGAATTACCTAATGGGAACATGGCCATTTGGAACCATCCTTTGCAAGATAGTGATCTC
CATAGATTACTATAACATGTTCACCAGCATATTCACCCTCTGCACCATGAGTGTTGATCGATACATTGCA
GTCTGCCACCCTGTCAAGGCCTTAGATTTCCGTACTCCCCGAAATGCCAAAATTATCAATGTCTGCAACT
GGATCCTCTCTTCAGCCATTGGTCTTCCTGTAATGTTCATGGCTACAACAAAATACAGGCAAGGTTCCAT
AGATTGTACACTAACATTCTCTCATCCAACCTGGTACTGGGAAAACCTGCTGAAGATCTGTGTTTTCATC
TTCGCCTTCATTATGCCAGTGCTCATCATTACCGTGTGCTATGGACTGATGATCTTGCGCCTCAAGAGTG
TCCGCATGCTCTCTGGCTCCAAAGAAAAGGACAGGAATCTTCGAAGGATCACCAGGATGGTGCTGGTGGT
GGTGGCTGTGTTCATCGTCTGCTGGACTCCCATTCACATTTACGTCATCATTAAAGCCTTGGTTACAATC
CCAGAAACTACGTTCCAGACTGTTTCTTGGCACTTCTGCATTGCTCTAGGTTACACAAACAGCTGCCTCA
ACCCAGTCCTTTATGCATTTCTGGATGAAAACTTCAAACGATGCTTCAGAGAGTTCTGTATCCCAACCTC
TTCCAACATTGAGCAACAAAACTCCACTCGAATTCGTCAGAACACTAGAGACCACCCCTCCACGGCCAAT
ACAGTGGATAGAACTAATCATCAGAATTATTATATAATTCATAGATGTTGCTGCAATACCCCTCTTATTT
CTCAAAAGCCAGTCTTGCTCTGGTTCTGTGATTAA


Restriction Sites SgfI-MluI     
ACCN NM_001285528
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001285528.1, NP_001272457.1
RefSeq Size 1068 bp
RefSeq ORF 945 bp
Locus ID 4988
Cytogenetics 6q25.2
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary 'This gene encodes one of at least three opioid receptors in humans; the mu opioid receptor (MOR). The MOR is the principal target of endogenous opioid peptides and opioid analgesic agents such as beta-endorphin and enkephalins. The MOR also has an important role in dependence to other drugs of abuse, such as nicotine, cocaine, and alcohol via its modulation of the dopamine system. The NM_001008503.2:c.118A>G allele has been associated with opioid and alcohol addiction and variations in pain sensitivity but evidence for it having a causal role is conflicting. Multiple transcript variants encoding different isoforms have been found for this gene. Though the canonical MOR belongs to the superfamily of 7-transmembrane-spanning G-protein-coupled receptors some isoforms of this gene have only 6 transmembrane domains. [provided by RefSeq, Oct 2013]'
Transcript Variant: This variant (MOR-3; also known as mu3) represents use of an alternate promoter and 5' UTR, uses a downstream start codon, and uses an alternate 3' exon, compared to variant MOR-1i. The resulting isoform (MOR-3) has a shorter N-terminus and a shorter and distinct C-terminus, compared to isoform MOR-1i.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.