FMO2 (NM_001301347) Human Untagged Clone

CAT#: SC335285

FMO2 (untagged) - Human flavin containing monooxygenase 2 (non-functional) (FMO2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FMO2
• Synonyms: FMO1B1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001301347, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCCGTATCTCTGAAGATGGCTATCCTTGGGACTCAGTGTTCCACACCCGGTTTCGTTCTATGCTCC
  GCAATGTACTGCCACGAACAGCTGTAAAATGGATGATAGAACAACAGATGAATCGGTGGTTCAACCATGA
  AAATTATGGCCTTGAGCCTCAAAACAAATACATTATGAAGGAACCTGTACTAAATGATGATGTCCCAAGT
  CGTCTACTCTGTGGAGCCATCAAGGTGAAATCTACAGTGAAAGAGCTCACAGAAACTTCTGCCATCTTTG
  AGGATGGAACAGTGGAGGAGAACATTGATGTCATCATTTTTGCAACAGGATATAGTTTCTCTTTTCCCTT
  CCTTGAAGATTCACTCGTTAAAGTAGAGAATAATATGGTCTCACTGTATAAATACATATTCCCCGCTCAC
  CTGGACAAGTCAACCCTCGCGTGCATTGGTCTCATCCAGCCCCTAGGTTCCATTTTCCCAACTGCTGAAC
  TTCAAGCTCGTTGGGTGACAAGAGTTTTCAAAGGCTTGTGTAGCCTGCCCTCAGAGAGAACTATGATGAT
  GGACATTATCAAAAGGAATGAAAAAAGAATTGACCTGTTTGGAGAAAGCCAGAGCCAGACGTTGCAGACC
  AATTATGTTGACTACTTGGACGAGCTCGCCTTAGAGATAGGTGCGAAGCCAGATTTCTGCTCTCTCTTGT
  TCAAAGATCCTAAACTGGCTGTGAGACTCTATTTCGGACCCTGCAACTCCTATCAGTATCGCCTGGTTGG
  GCCTGGGCAATGGGAAGGAGCCAGAAATGCCATCTTCACCCAGAAACAAAGAATACTGAAGCCACTCAAG
  ACTCGGGCCCTGAAGGATTCATCTAATTTCTCAGTTTCTTTTCTGTTGAAAATCCTGGGCCTTCTTGCTG
  TTGTTGTGGCCTTTTTTTGCCAACTTCAATGGTCCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301347
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001301347.1, NP_001288276.1
• RefSeq Size: 5023 bp
• RefSeq ORF: 948 bp
• Locus ID: 2327
• Cytogenetics: 1q24.3
• Protein Pathways: Drug metabolism - cytochrome P450
• Gene Summary: 'This gene encodes a flavin-containing monooxygenase family member. It is an NADPH-dependent enzyme that catalyzes the N-oxidation of some primary alkylamines through an N-hydroxylamine intermediate. However, some human populations contain an allele (FMO2*2A) with a premature stop codon, resulting in a protein that is C-terminally-truncated, has no catalytic activity, and is likely degraded rapidly. This gene is found in a cluster with other related family members on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]'
  Transcript Variant: This variant (3) lacks two alternate exons, and it thus differs in its 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a.