TSEN34 (NM_001282333) Human Untagged Clone

CAT#: SC335286

TSEN34 (untagged) - Human TSEN34 tRNA splicing endonuclease subunit (TSEN34), transcript variant 4


  "NM_001282333" in other vectors (1)

Reconstitution Protocol

USD 320.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "TSEN34"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TSEN34
Synonyms LENG5; PCH2C; SEN34; SEN34L
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282333, the custom clone sequence may differ by one or more nucleotides


ATGAGGAGGATGCTGGTGGTGGAGGTGGCGAACGGCCGCTCCCTGGTGTGGGGAGCCGAGGCGGTGCAGG
CCCTCCGGGAGCGCCTGGGTGTGGGGGGCCGCACGGTAGGCGCCCTGCCCCGCGGGCCCCGCCAGAACTC
GCGCCTGGGCCTCCCGCTGCTGCTGATGCCCGAAGAGGCGCGGCTCTTGGCCGAGATCGGCGCCGTGACT
CTGGTCAGCGCCCCGCGTCCAGACTCTCGGCACCACAGCCTGGCCCTGACATCCTTCAAGCGCCAGCAAG
AGGAGAGCTTCCAGGAGCAGAGCGCCTTGGCAGCTGAGGCCCGGGAGACCCGTCGTCAGGAGCTCCTGGA
GAAGATTACGGAGGGCCAGGCTGCTAAGAAGCAGAAACTAGAACAGGCTTCAGGGGCCAGCTCAAGCCAG
GAGGCCGGCTCGAGCCAGGCTGCCAAAGAGGATGAGACCAGTGATGGCCAGGCTTCGGGAGAGCAGGAGG
AAGCTGGCCCCTCGTCTTCCCAAGCAGGACCCTCAAATGGGGTAGCCCCCTTGCCCAGATCTGCTCTCCT
TGTCCAGCTGGCCACTGCCAGGCCTCGACCGGTCAAGGCCAGGCCCCTGGACTGGCGTGTCCAGTCTAAA
GACTGGCCCCACGCCGGCCGCCCTGCCCACGAGCTGCGCTACAGTATCTACAGAGACCTGTGGGAGCGAG
GCTTCTTCCTCAGTGCGGCTGGCAAGTTCGGAGGTGACTTCCTGGTCTATCCTGGTGACCCCCTCCGCTT
CCACGCCCATTATATCGCTCAGTGCTGGGCCCCTGAGGACACCATCCCACTCCAAGACCTGGTTGCTGCT
GGGCGCCTTGGAACCAGCGTCAGAAAGACCCTGCTCCTCTGTTCTCCGCAGCCTGATGGGTTTAAGTCTC
AGGAGGTCTCAATAAACTTGGTATATAAATGTTCATGA


Restriction Sites SgfI-MluI     
ACCN NM_001282333
ORF Size 948 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001282333.1, NP_001269262.1
RefSeq Size 1912
RefSeq ORF 948
Locus ID 79042
Gene Summary This gene encodes a catalytic subunit of the tRNA splicing endonuclease, which catalyzes the removal of introns from precursor tRNAs. The endonuclease complex is also associated with a pre-mRNA 3-prime end processing factor. A mutation in this gene results in the neurological disorder pontocerebellar hypoplasia type 2. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (4) differs in the 5' UTR and 3' coding region, compared to variant 1. The encoded isoform (2) has a longer and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.