B3GAT3 (NM_001288723) Human Untagged Clone

CAT#: SC335287

B3GAT3 (untagged) - Human beta-1,3-glucuronyltransferase 3 (B3GAT3), transcript variant 4


  "NM_001288723" in other vectors (1)

Reconstitution Protocol

USD 320.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "B3GAT3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol B3GAT3
Synonyms GLCATI; glcUAT-I; JDSCD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001288723, the custom clone sequence may differ by one or more nucleotides


ATGAAGCTGAAGCTGAAGAACGTGTTTCTCGCCTACTTCCTGGTGTCGATCGCCGGCCTCCTCTACGCGC
TGGTACAGCTCGGCCAGCCATGTGACTGCCTTCCTCCCCTGCGGGCAGCAGCCGAGCAGCTACGGCAGAA
GGATCTGAGGATTTCCCAGCTGCAAGCGGAACTCCGACGGCCACCCCCTGCCCCTGCCCAGCCCCCTGAA
CCCGAGGCCCTGCCTACTATCTATGTTGTTACCCCCACCTATGCCAGGCTGGTACAGAAGGCAGAGCTGG
TACGACTGTCCCAGACACTGAGCCTGGTGCCCCGGCTGCATTGGCTGCTGGTGGAGGATGCTGAGGGTCC
CACCCCGCTGGTCTCAGGGCTGCTGGCTGCCTCTGGCCTCCTCTTCACACACCTGGTGGTCCTCACGCCC
AAAGCCCAGCGGCTTCGGGAGGGCGAGCCTGGCTGGGTTCATCCCCGTGGTGTCGAGCAGCGGAACAAGG
CCCTGGACTGGCTCCGGGGCAGAGGGGGTGCTGTGGGTGGGGAGAAGGACCCACCACCACCAGGGACCCA
AGGAGTCGTCTACTTTGCTGACGATGACAACACCTACAGCCGGGAGCTGTTTGAGGAGATGCGCTGGACC
CGTGGTGTCTCAGTGTGGCCTGTGGGGCTGGTGGGCGGCCTGCGATTCGAGGGCCCTCAGGTACAGGACG
GCCGGGTAGTGGGCTTCCACACAGCATGGGAGCCCAGCAGGCCCTTCCCTGTGGATATGGCTGGATTTGC
CGTGGCCCTGCCCTTGCTGTTAGATAAGCCCAATGCCCAATTTGATTCCACCGCTCCCCGGGGCCACCTG
GAGAGCAGTCTTCTGAGCCACCTTGTGGATCCCAAGGACCTGGAGCCACGGGCTGCCAACTGCACTCGGA
CAGAGTCTCGCTGTGTCACCCAGGCTGGAGTGCAGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001288723
ORF Size 948 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001288723.1, NP_001275652.1
RefSeq Size 2098
RefSeq ORF 948
Locus ID 26229
Protein Families Transmembrane
Protein Pathways Chondroitin sulfate biosynthesis, Heparan sulfate biosynthesis, Metabolic pathways
Gene Summary The protein encoded by this gene is a member of the glucuronyltransferase gene family, enzymes that exhibit strict acceptor specificity, recognizing nonreducing terminal sugars and their anomeric linkages. This gene product catalyzes the formation of the glycosaminoglycan-protein linkage by way of a glucuronyl transfer reaction in the final step of the biosynthesis of the linkage region of proteoglycans. A pseudogene of this gene has been identified on chromosome 3. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (4) uses an alternate splice site in its 3' coding region, compared to variant 1. The encoded isoform (4) has a shorter and distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.