Heme oxygenase 2 (HMOX2) (NM_001286268) Human Untagged Clone
CAT#: SC335295
HMOX2 (untagged) - Human heme oxygenase (decycling) 2 (HMOX2), transcript variant 6
"NM_001286268" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HMOX2 |
Synonyms | HO-2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001286268, the custom clone sequence may differ by one or more nucleotides
ATGTCAGCGGAAGTGGAAACCTCAGAGGGGGTAGACGAGTCAGAAAAAAAGAACTCTGGGGCCCTAGAAA AGGAGAACCAAATGAGAATGGCTGACCTCTCGGAGCTCCTGAAGGAAGGGACCAAGGAAGCACACGACCG GGCAGAAAACACCCAGTTTGTCAAGGACTTCTTGAAAGGCAACATTAAGAAGGAGCTGTTTAAGCTGGCC ACCACGGCACTTTACTTCACATACTCAGCCCTCGAGGAGGAAATGGAGCGCAACAAGGACCATCCAGCCT TTGCCCCTTTGTACTTCCCCATGGAGCTGCACCGGAAGGAGGCGCTGACCAAGGACATGGAGTATTTCTT TGGTGAAAACTGGGAGGAGCAGGTGCAGTGCCCCAAGGCTGCCCAGAAGTACGTGGAGCGGATCCACTAC ATAGGGCAGAACGAGCCGGAGCTACTGGTGGCCCATGCATACACCCGCTACATGGGGGATCTCTCGGGGG GCCAGGTGCTGAAGAAGGTGGCCCAGCGAGCACTGAAACTCCCCAGCACAGGGGAAGGGACCCAGTTCTA CCTGTTTGAGAATGTGGACAATGCCCAGCAGTTCAAGCAGCTCTACCGGGCCAGGATGAACGCCCTGGAC CTGAACATGAAGACCAAAGAGAGGATCGTGGAGGAGGCCAACAAGGCTTTTGAGTATAACATGCAGATAT TCAATGAACTGGACCAGGCCGGCTCCACACTGGCCAGAGAGACCTTGGAGGATGGGTTCCCTGTACACGA TGGGAAAGGAGACATGCGTAAATGCCCTTTCTACGCTGCTGAACAAGACAAAGGTGCCCTGGAGGGCAGC AGCTGTCCCTTCCGAACAGCTATGGCTGTGCTGAGGAAGCCCAGCCTCCAGTTCATCCTGGCCGCTGGTG TGGCCCTAGCTGCTGGACTCTTGGCCTGGTACTACATGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286268 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001286268.1, NP_001273197.1 |
RefSeq Size | 1932 bp |
RefSeq ORF | 951 bp |
Locus ID | 3163 |
Cytogenetics | 16p13.3 |
Protein Families | Transmembrane |
Protein Pathways | Porphyrin and chlorophyll metabolism |
Gene Summary | 'Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. Several alternatively spliced transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]' Transcript Variant: This variant (6) differs in the 5' UTR and coding sequence compared to variant 5. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 1, 2, 3, 4, 6, 7, and 8 all encode the same isoform (b). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237401 | HMOX2 (myc-DDK-tagged) - Human heme oxygenase (decycling) 2 (HMOX2), transcript variant 6 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review