IDH2 (NM_001290114) Human Untagged Clone

CAT#: SC335334

IDH2 (untagged) - Human isocitrate dehydrogenase 2 (NADP+), mitochondrial (IDH2), transcript variant 3


  "NM_001290114" in other vectors (1)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "IDH2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IDH2
Synonyms D2HGA2; ICD-M; IDH; IDHM; IDP; IDPM; mNADP-IDH
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001290114, the custom clone sequence may differ by one or more nucleotides


ATGTGGAAAAGTCCCAATGGAACTATCCGGAACATCCTGGGGGGGACTGTCTTCCGGGAGCCCATCATCT
GCAAAAACATCCCACGCCTAGTCCCTGGCTGGACCAAGCCCATCACCATTGGCAGGCACGCCCATGGCGA
CCAGTACAAGGCCACAGACTTTGTGGCAGACCGGGCCGGCACTTTCAAAATGGTCTTCACCCCAAAAGAT
GGCAGTGGTGTCAAGGAGTGGGAAGTGTACAACTTCCCCGCAGGCGGCGTGGGCATGGGCATGTACAACA
CCGACGAGTCCATCTCAGGTTTTGCGCACAGCTGCTTCCAGTATGCCATCCAGAAGAAATGGCCGCTGTA
CATGAGCACCAAGAACACCATACTGAAAGCCTACGATGGGCGTTTCAAGGACATCTTCCAGGAGATCTTT
GACAAGCACTATAAGACCGACTTCGACAAGAATAAGATCTGGTATGAGCACCGGCTCATTGATGACATGG
TGGCTCAGGTCCTCAAGTCTTCGGGTGGCTTTGTGTGGGCCTGCAAGAACTATGACGGAGATGTGCAGTC
AGACATCCTGGCCCAGGGCTTTGGCTCCCTTGGCCTGATGACGTCCGTCCTGGTCTGCCCTGATGGGAAG
ACGATTGAGGCTGAGGCCGCTCATGGGACCGTCACCCGCCACTATCGGGAGCACCAGAAGGGCCGGCCCA
CCAGCACCAACCCCATCGCCAGCATCTTTGCCTGGACACGTGGCCTGGAGCACCGGGGGAAGCTGGATGG
GAACCAAGACCTCATCAGGTTTGCCCAGATGCTGGAGAAGGTGTGCGTGGAGACGGTGGAGAGTGGAGCC
ATGACCAAGGACCTGGCGGGCTGCATTCACGGCCTCAGCAATGTGAAGCTGAACGAGCACTTCCTGAACA
CCACGGACTTCCTCGACACCATCAAGAGCAACCTGGACAGAGCCCTGGGCAGGCAGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001290114
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290114.1, NP_001277043.1
RefSeq Size 1560 bp
RefSeq ORF 969 bp
Locus ID 3418
Cytogenetics 15q26.1
Protein Pathways Citrate cycle (TCA cycle), Glutathione metabolism, Metabolic pathways
Gene Summary 'Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the mitochondria. It plays a role in intermediary metabolism and energy production. This protein may tightly associate or interact with the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]'
Transcript Variant: This variant (3) lacks two alternate exons and initiates translation at a downstream start codon compared to variant 1. The resulting isoform (3) is shorter at the N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.