SLC25A14 (NM_001282196) Human Untagged Clone

CAT#: SC335338

SLC25A14 (untagged) - Human solute carrier family 25 (mitochondrial carrier, brain), member 14 (SLC25A14), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC25A14
• Synonyms: BMCP1; UCP5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282196, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGTATCTTTCCCGGAATAATCCTAATTTTTCTAAGGGTGAAGTTTGCAACGGCGGCCGTGATTCACC
  AGAAAAGTACCACTGTAAGTCATGAGATGTCTGGTCTGAATTGGAAACCCTTTGTATATGGCGGCCTTGC
  CTCTATCGTGGCTGAGTTTGGGACTTTCCCTGTGGACCTTACCAAAACACGACTTCAGGTTCAAGGCCAA
  AGCATTGATGCCCGTTTCAAAGAGATAAAATATAGAGGGATGTTCCATGCGCTGTTTCGCATCTGTAAAG
  AGGAAGGTGTATTGGCTCTCTATTCAGGAATTGCTCCTGCGTTGCTAAGACAAGCATCATATGGCACCAT
  TAAAATTGGGATTTACCAAAGCTTGAAGCGCTTATTCGTAGAACGTTTAGAAGATGAAACTCTTTTAATT
  AATATGATCTGTGGGGTAGTGTCAGGAGTGATATCTTCCACTATAGCCAATCCCACCGATGTTCTAAAGA
  TTCGAATGCAGGCTCAAGGAAGCTTGTTCCAAGGGAGCATGATTGGAAGCTTTATCGATATATACCAACA
  AGAAGGCACCAGGGGTCTGTGGAGGGGTGTGGTTCCAACTGCTCAGCGTGCTGCCATCGTTGTAGGAGTA
  GAGCTACCAGTCTATGATATTACTAAGAAGCATTTAATATTGTCAGGAATGATGGGCGATACAATTTTAA
  CTCACTTCGTTTCCAGCTTTACATGTGGTTTGGCTGGGGCTCTGGCCTCCAACCCGGTTGATGTGGTTCG
  AACTCGCATGATGAACCAGAGGGCAATCGTGGGACATGTGGATCTCTATAAGGGCACTGTTGATGGTATT
  TTAAAGATGTGGAAACATGAGGGCTTTTTTGCACTCTATAAAGGATTTTGGCCAAACTGGCTTCGGCTTG
  GACCCTGGAACATCATTTTTTTTATTACATACGAGCAGCTAAAGAGGCTTCAAATCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282196
• ORF Size: 969 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001282196.1, NP_001269125.1
• RefSeq Size: 1647
• RefSeq ORF: 969
• Locus ID: 9016
• Protein Families: Druggable Genome
• Gene Summary: Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). Uncoupling proteins separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. Uncoupling proteins facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. This gene is widely expressed in many tissues with the greatest abundance in brain and testis. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 4. [provided by RefSeq, Aug 2013]
  Transcript Variant: This variant (2, also known as UCP5S or short) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1.