SLC25A14 (NM_001282195) Human Untagged Clone

CAT#: SC335347

SLC25A14 (untagged) - Human solute carrier family 25 (mitochondrial carrier, brain), member 14 (SLC25A14), transcript variant 1


  "NM_001282195" in other vectors (1)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "SLC25A14"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLC25A14
Synonyms BMCP1; UCP5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282195, the custom clone sequence may differ by one or more nucleotides


ATGGGTATCTTTCCCGGAATAATCCTAATTTTTCTAAGGGTGAAGTTTGCAACGGCGGCCGTGATTGTAA
GCGGACACCAGAAAAGTACCACTGTAAGTCATGAGATGTCTGGTCTGAATTGGAAACCCTTTGTATATGG
CGGCCTTGCCTCTATCGTGGCTGAGTTTGGGACTTTCCCTGTGGACCTTACCAAAACACGACTTCAGGTT
CAAGGCCAAAGCATTGATGCCCGTTTCAAAGAGATAAAATATAGAGGGATGTTCCATGCGCTGTTTCGCA
TCTGTAAAGAGGAAGGTGTATTGGCTCTCTATTCAGGAATTGCTCCTGCGTTGCTAAGACAAGCATCATA
TGGCACCATTAAAATTGGGATTTACCAAAGCTTGAAGCGCTTATTCGTAGAACGTTTAGAAGATGAAACT
CTTTTAATTAATATGATCTGTGGGGTAGTGTCAGGAGTGATATCTTCCACTATAGCCAATCCCACCGATG
TTCTAAAGATTCGAATGCAGGCTCAAGGAAGCTTGTTCCAAGGGAGCATGATTGGAAGCTTTATCGATAT
ATACCAACAAGAAGGCACCAGGGGTCTGTGGAGGGGTGTGGTTCCAACTGCTCAGCGTGCTGCCATCGTT
GTAGGAGTAGAGCTACCAGTCTATGATATTACTAAGAAGCATTTAATATTGTCAGGAATGATGGGCGATA
CAATTTTAACTCACTTCGTTTCCAGCTTTACATGTGGTTTGGCTGGGGCTCTGGCCTCCAACCCGGTTGA
TGTGGTTCGAACTCGCATGATGAACCAGAGGGCAATCGTGGGACATGTGGATCTCTATAAGGGCACTGTT
GATGGTATTTTAAAGATGTGGAAACATGAGGGCTTTTTTGCACTCTATAAAGGATTTTGGCCAAACTGGC
TTCGGCTTGGACCCTGGAACATCATTTTTTTTATTACATACGAGCAGCTAAAGAGGCTTCAAATCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001282195
ORF Size 978 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001282195.1, NP_001269124.1
RefSeq Size 1656
RefSeq ORF 978
Locus ID 9016
Protein Families Druggable Genome
Gene Summary Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). Uncoupling proteins separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. Uncoupling proteins facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. This gene is widely expressed in many tissues with the greatest abundance in brain and testis. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 4. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (1, also known as UCP5L or long) encodes isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.