P2Y6 (P2RY6) (NM_001277204) Human Untagged Clone

CAT#: SC335363

P2RY6 (untagged) - Human pyrimidinergic receptor P2Y, G-protein coupled, 6 (P2RY6), transcript variant 5


  "NM_001277204" in other vectors (1)

Reconstitution Protocol

USD 340.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "P2RY6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol P2RY6
Synonyms P2Y6
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001277204, the custom clone sequence may differ by one or more nucleotides


ATGGAATGGGACAATGGCACAGGCCAGGCTCTGGGCTTGCCACCCACCACCTGTGTCTACCGCGAGAACT
TCAAGCAACTGCTGCTGCCACCTGTGTATTCGGCGGTGCTGGCGGCTGGCCTGCCGCTGAACATCTGTGT
CATTACCCAGATCTGCACGTCCCGCCGGGCCCTGACCCGCACGGCCGTGTACACCCTAAACCTTGCTCTG
GCTGACCTGCTATATGCCTGCTCCCTGCCCCTGCTCATCTACAACTATGCCCAAGGTGATCACTGGCCCT
TTGGCGACTTCGCCTGCCGCCTGGTCCGCTTCCTCTTCTATGCCAACCTGCACGGCAGCATCCTCTTCCT
CACCTGCATCAGCTTCCAGCGCTACCTGGGCATCTGCCACCCGCTGGCCCCCTGGCACAAACGTGGGGGC
CGCCGGGCTGCCTGGCTAGTGTGTGTAGCCGTGTGGCTGGCCGTGACAACCCAGTGCCTGCCCACAGCCA
TCTTCGCTGCCACAGGCATCCAGCGTAACCGCACTGTCTGCTATGACCTCAGCCCGCCTGCCCTGGCCAC
CCACTATATGCCCTATGGCATGGCTCTCACTGTCATCGGCTTCCTGCTGCCCTTTGCTGCCCTGCTGGCC
TGCTACTGTCTCCTGGCCTGCCGCCTGTGCCGCCAGGATGGCCCGGCAGAGCCTGTGGCCCAGGAGCGGC
GTGGCAAGGCGGCCCGCATGGCCGTGGTGGTGGCTGCTGCCTTTGCCATCAGCTTCCTGCCTTTTCACAT
CACCAAGACAGCCTACCTGGCAGTGCGCTCGACGCCGGGCGTCCCCTGCACTGTATTGGAGGCCTTTGCA
GCGGCCTACAAAGGCACGCGGCCGTTTGCCAGTGCCAACAGCGTGCTGGACCCCATCCTCTTCTACTTCA
CCCAGAAGAAGTTCCGCCGGCGACCACATGAGCTCCTACAGAAACTCACAGCCAAATGGCAGAGGCAGGG
TCGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001277204
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001277204.1, NP_001264133.1
RefSeq Size 2552 bp
RefSeq ORF 987 bp
Locus ID 5031
Cytogenetics 11q13.4
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary 'The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, which is a G-protein coupled receptor, is responsive to UDP, partially responsive to UTP and ADP, and not responsive to ATP. It is proposed that this receptor mediates inflammatory responses. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Mar 2013]'
Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. Variants 1,2,3,5,6,7, and 8 encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.