P2Y6 (P2RY6) (NM_001277204) Human Untagged Clone
CAT#: SC335363
P2RY6 (untagged) - Human pyrimidinergic receptor P2Y, G-protein coupled, 6 (P2RY6), transcript variant 5
"NM_001277204" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | P2RY6 |
Synonyms | P2Y6 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001277204, the custom clone sequence may differ by one or more nucleotides
ATGGAATGGGACAATGGCACAGGCCAGGCTCTGGGCTTGCCACCCACCACCTGTGTCTACCGCGAGAACT TCAAGCAACTGCTGCTGCCACCTGTGTATTCGGCGGTGCTGGCGGCTGGCCTGCCGCTGAACATCTGTGT CATTACCCAGATCTGCACGTCCCGCCGGGCCCTGACCCGCACGGCCGTGTACACCCTAAACCTTGCTCTG GCTGACCTGCTATATGCCTGCTCCCTGCCCCTGCTCATCTACAACTATGCCCAAGGTGATCACTGGCCCT TTGGCGACTTCGCCTGCCGCCTGGTCCGCTTCCTCTTCTATGCCAACCTGCACGGCAGCATCCTCTTCCT CACCTGCATCAGCTTCCAGCGCTACCTGGGCATCTGCCACCCGCTGGCCCCCTGGCACAAACGTGGGGGC CGCCGGGCTGCCTGGCTAGTGTGTGTAGCCGTGTGGCTGGCCGTGACAACCCAGTGCCTGCCCACAGCCA TCTTCGCTGCCACAGGCATCCAGCGTAACCGCACTGTCTGCTATGACCTCAGCCCGCCTGCCCTGGCCAC CCACTATATGCCCTATGGCATGGCTCTCACTGTCATCGGCTTCCTGCTGCCCTTTGCTGCCCTGCTGGCC TGCTACTGTCTCCTGGCCTGCCGCCTGTGCCGCCAGGATGGCCCGGCAGAGCCTGTGGCCCAGGAGCGGC GTGGCAAGGCGGCCCGCATGGCCGTGGTGGTGGCTGCTGCCTTTGCCATCAGCTTCCTGCCTTTTCACAT CACCAAGACAGCCTACCTGGCAGTGCGCTCGACGCCGGGCGTCCCCTGCACTGTATTGGAGGCCTTTGCA GCGGCCTACAAAGGCACGCGGCCGTTTGCCAGTGCCAACAGCGTGCTGGACCCCATCCTCTTCTACTTCA CCCAGAAGAAGTTCCGCCGGCGACCACATGAGCTCCTACAGAAACTCACAGCCAAATGGCAGAGGCAGGG TCGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001277204 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001277204.1, NP_001264133.1 |
RefSeq Size | 2552 bp |
RefSeq ORF | 987 bp |
Locus ID | 5031 |
Cytogenetics | 11q13.4 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Neuroactive ligand-receptor interaction |
Gene Summary | 'The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, which is a G-protein coupled receptor, is responsive to UDP, partially responsive to UTP and ADP, and not responsive to ATP. It is proposed that this receptor mediates inflammatory responses. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Mar 2013]' Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. Variants 1,2,3,5,6,7, and 8 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237469 | P2RY6 (myc-DDK-tagged) - Human pyrimidinergic receptor P2Y, G-protein coupled, 6 (P2RY6), transcript variant 5 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review