HSPC142 (BABAM1) (NM_001288756) Human Untagged Clone

CAT#: SC335375

BABAM1 (untagged) - Human BRISC and BRCA1 A complex member 1 (BABAM1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BABAM1
• Synonyms: C19orf62; HSPC142; MERIT40; NBA1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001288756, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAAGTGGCAGAGCCCAGCAGCCCCACTGAAGAGGAGGAGGAGGAAGAGGAGCACTCGGCAGAGCCTC
  GGCCCCGCACTCGCTCCAATCCTGAAGGGGCTGAGGACCGGGCAGTAGGGGCACAGGCCAGCGTGGGCAG
  CCGCAGCGAGGGTGAGGGTGAGGCCGCCAGTGCTGATGATGGGAGCCTCAACACTTCAGGAGCCGGCCCT
  AAGTCCTGGCAGGTGCCCCCGCCAGCCCCTGAGGTCCAAATTCGGACACCAAGGGTCAACTGTCCAGAGA
  AAGTGATTATCTGCCTGGACCTGTCAGAGGAAATGTCACTGCCAAAGCTGGAGTCGTTCAACGGCTCCAA
  AACCAACGCCCTCAATGTCTCCCAGAAGATGATTGAGATGTTCGTGCGGACAAAACACAAGATCGACAAA
  AGCCACGAGTTTGCACTGGTGGTGGTGAACGATGACACGGCCTGGCTGTCTGGCCTGACCTCCGACCCCC
  GCGAGCTCTGTAGCTGCCTCTATGATCTGGAGACGGCCTCCTGTTCCACCTTCAATCTGGAAGGACTTTT
  CAGCCTCATCCAGCAGAAAACTGAGCTTCCGGTCACAGAGAACGTGCAGACGATTCCCCCGCCATATGTG
  GTCCGCACCATCCTTGTCTACAGCCGTCCACCTTGCCAGCCCCAGTTCTCCTTGACGGAGCCCATGAAGA
  AAATGTTCCAGTGCCCATATTTCTTCTTTGACGTTGTTTACATCCACAATGGCACTGAGGAGAAGGAGGA
  GGAGATGAGTTGGAAGGATATGTTTGCCTTCATGGGCAGCCTGGATACCAAGGGTACCAGCTACAAGTAT
  GAGGTGGCACTGGCTGGGCCAGCCCTGGAGTTGCACAACTGCATGGCGAAACTGTTGGCCCACCCCCTGC
  AGCGGCCTTGCCAGAGCCATGCTTCCTACAGCCTGCTGGAGGAGGAGGATGAAGCCATTGAGGTTGAGGC
  CACTGTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001288756
• ORF Size: 990 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001288756.1, NP_001275685.1
• RefSeq Size: 1456
• RefSeq ORF: 990
• Locus ID: 29086
• Gene Summary: Component of the BRCA1-A complex, a complex that specifically recognizes 'Lys-63'-linked ubiquitinated histones H2A and H2AX at DNA lesions sites, leading to target the BRCA1-BARD1 heterodimer to sites of DNA damage at double-strand breaks (DSBs). The BRCA1-A complex also possesses deubiquitinase activity that specifically removes 'Lys-63'-linked ubiquitin on histones H2A and H2AX. In the BRCA1-A complex, it is required for the complex integrity and its localization at DSBs. Component of the BRISC complex, a multiprotein complex that specifically cleaves 'Lys-63'-linked ubiquitin in various substrates (PubMed:24075985, PubMed:26195665). In these 2 complexes, it is probably required to maintain the stability of BABAM2 and help the 'Lys-63'-linked deubiquitinase activity mediated by BRCC3/BRCC36 component. The BRISC complex is required for normal mitotic spindle assembly and microtubule attachment to kinetochores via its role in deubiquitinating NUMA1 (PubMed:26195665). Plays a role in interferon signaling via its role in the deubiquitination of the interferon receptor IFNAR1; deubiquitination increases IFNAR1 activity by enhancing its stability and cell surface expression (PubMed:24075985). Down-regulates the response to bacterial lipopolysaccharide (LPS) via its role in IFNAR1 deubiquitination (PubMed:24075985). [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 2 and 3 encode the same isoform (1).