GRAP2 (NM_001291824) Human Untagged Clone

CAT#: SC335382

GRAP2 (untagged) - Human GRB2-related adaptor protein 2 (GRAP2), transcript variant 1


  "NM_001291824" in other vectors (1)

Reconstitution Protocol

USD 340.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "GRAP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GRAP2
Synonyms GADS; GRAP-2; GRB2L; GRBLG; GrbX; Grf40; GRID; GRPL; Mona; P38
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001291824, the custom clone sequence may differ by one or more nucleotides


ATGGAAGCTGTTGCCAAGTTTGATTTCACTGCTTCAGGTGAGGATGAACTGAGCTTTCACACTGGAGATG
TTTTGAAGATTTTAAGTAACCAAGAGGAGTGGTTTAAGGCGGAGCTTGGGAGCCAGGAAGGATATGTGCC
CAAGAATTTCATAGACATCCAGTTTCCCAAATGGTTTCACGAAGGCCTCTCTCGACACCAGGCAGAGAAC
TTACTCATGGGCAAGGAGGTTGGCTTCTTCATCATCCGGGCCAGCCAGAGCTCCCCAGGGGACTTCTCCA
TCTCTGTCAGGCATGAGGATGACGTTCAACACTTCAAGGTCATGCGAGACAACAAGGGTAATTACTTTCT
GTGGACTGAGAAGTTTCCATCCCTAAATAAGCTGGTAGACTACTACAGGACAAATTCCATCTCCAGACAG
AAGCAGATCTTCCTTAGAGACAGAACCCGAGAAGACCAGGGTCACCGGGGCAACAGCCTGGACCGGAGGT
CCCAGGGAGGCCCACACCTCAGTGGGGCTGTGGGAGAAGAAATCCGACCTTCGATGAACCGGAAGCTGTC
GGATCACCCCCCGACCCTTCCCCTGCAGCAGCACCAGCACCAGCCACAGCCTCCGCAATATGCCCCAGCG
CCCCAGCAGCTGCAGCAGCCCCCACAGCAGCGATATCTGCAGCACCACCATTTCCACCAGGAACGCCGAG
GAGGCAGCCTTGACATAAATGATGGGCATTGTGGCACCGGCTTGGGCAGTGAAATGAATGCGGCCCTCAT
GCATCGGAGACACACAGACCCAGTGCAGCTCCAGGCGGCAGGGCGAGTGCGGTGGGCCCGGGCGCTGTAT
GACTTTGAGGCCCTGGAGGATGACGAGCTGGGGTTCCACAGCGGGGAGGTGGTGGAGGTCCTGGATAGCT
CCAACCCATCCTGGTGGACCGGCCGCCTGCACAACAAGCTGGGCCTCTTCCCTGCCAACTACGTGGCACC
CATGACCCGATAA


Restriction Sites SgfI-MluI     
ACCN NM_001291824
ORF Size 993 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001291824.1, NP_001278753.1
RefSeq Size 3528
RefSeq ORF 993
Locus ID 9402
Protein Families Druggable Genome
Protein Pathways T cell receptor signaling pathway
Gene Summary This gene encodes a member of the GRB2/Sem5/Drk family. This member is an adaptor-like protein involved in leukocyte-specific protein-tyrosine kinase signaling. Like its related family member, GRB2-related adaptor protein (GRAP), this protein contains an SH2 domain flanked by two SH3 domains. This protein interacts with other proteins, such as GRB2-associated binding protein 1 (GAB1) and the SLP-76 leukocyte protein (LCP2), through its SH3 domains. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (1) encodes the longest isoform (1). Variants 1, 2 and 3 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.