RhoGDI (ARHGDIA) (NM_001301242) Human Untagged Clone
CAT#: SC335443
ARHGDIA (untagged) - Human Rho GDP dissociation inhibitor (GDI) alpha (ARHGDIA), transcript variant 6
"NM_001301242" in other vectors (1)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | ARHGDIA |
| Synonyms | GDIA1; HEL-S-47e; NPHS8; RHOGDI; RHOGDI-1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001301242, the custom clone sequence may differ by one or more nucleotides
ATGGCTGAGCAGGAGCCCACAGCCGAGCAGCTGGCCCAGATTGCAGCGGAGAACGAGGAGGATGAGCACT CGGTCAACTACAAGCCCCCGGCCCAGAAGAGCATCCAGGAGATCCAGGAGCTGGACAAGGACGACGAGAG CCTGCGAAAGTACAAGGAGGCCCTGCTGGGCCGCGTGGCCGTTTCCGCAGACCCCAACGTCCCCAACGTC GTGGTGACTGGCCTGACCCTGGTGTGCAGCTCGGCCCCGGGCCCCCTGGAGCTGGACCTGACGGGCGACC TGGAGAGCTTCAAGAAGCAGTCGTTTGTGCTGAAGGAGGGTGTGGAGTACCGGATAAAAATCTCTTTCCG GGTTAACCGAGAGATAGTGTCCGGCATGAAGTACATCCAGCATACGTACAGGAAAGGCGTCAAGATTGAC AAGACTGACTACATGACGACGACAAGACCGACCACCTGTCCTGGGAGTGGAATCTCACCATCAAGAAGGA CTGGAAGGACTGAGCCCAGCCAGAGGCGGGCAGGGCAGACTGACGGACGGACGACGGACAGGCGGATGTG TCCCCCCCAGCCCCTCCCCTCCCCATACCAAAGTGCTGACAGGCCCTCCGTGCCCCTCCCACCCTGGTCC GCCTCCCTGGCCTGGCTCAACCGAGTGCCTCCGACCCCCCTCCTCAGCCCTCCCCCACCCACAGGCCCAG CCTCCTCGGTCTCCTGTCTCGTTGCTGCTTCTGCCTGTGCTGTGGGGGAGAGAGGCCGCAGCCAGGCCTC TGCTGCCCTTTCTGTGCCCCCCAGGTTCTATCTCCCCGTCACACCCGAGGCCTGGCTTCAGGAGGGAGCG GAGCAGCCATTCTCCAGGCCCCGTGGTTGCCCCTGGACGTGTGCGTCTGCTGCTCCGGGGTGGAGCTGGG GTGTGGGATGCACGGCCTCGTGGGGGCCGGGCCGTCCTCCAGCCCCGCTGCTCCCTGGCCAGCCCCCTTG TCGCTGTCGGTCCCGTCTAACCATGATGCCTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001301242 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001301242.1, NP_001288171.1 |
| RefSeq Size | 1808 bp |
| RefSeq ORF | 1014 bp |
| Locus ID | 396 |
| Cytogenetics | 17q25.3 |
| Protein Families | Druggable Genome |
| Protein Pathways | Neurotrophin signaling pathway |
| Gene Summary | 'This gene encodes a protein that plays a key role in the regulation of signaling through Rho GTPases. The encoded protein inhibits the disassociation of Rho family members from GDP (guanine diphosphate), thereby maintaining these factors in an inactive state. Activity of this protein is important in a variety of cellular processes, and expression of this gene may be altered in tumors. Mutations in this gene have been found in individuals with nephrotic syndrome, type 8. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]' Transcript Variant: This variant (6) differs in the 5' UTR and lacks an alternate segment in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (d) is longer than isoform a. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC237549 | ARHGDIA (myc-DDK-tagged) - Human Rho GDP dissociation inhibitor (GDI) alpha (ARHGDIA), transcript variant 6 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China