Cytohesin 1 (CYTH1) (NM_001292019) Human Untagged Clone

CAT#: SC335458

CYTH1 (untagged) - Human cytohesin 1 (CYTH1), transcript variant 4


  "NM_001292019" in other vectors (1)

Reconstitution Protocol

USD 350.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "CYTH1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CYTH1
Synonyms B2-1; CYTOHESIN-1; D17S811E; PSCD1; SEC7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001292019, the custom clone sequence may differ by one or more nucleotides


ATGCAGAGGAACAAACAGGTAGCCATGGGCAGGAAAAAATTTAATATGGACCCTAAAAAGGGGATCCAGT
TCTTAATAGAGAACGACCTCCTGAAGAACACTTGTGAAGACATTGCCCAGTTCTTATATAAAGGCGAAGG
GCTCAACAAGACAGCCATCGGCGACTACCTAGGGGAGAGAGATGAGTTTAATATCCAGGTTCTTCATGCA
TTTGTGGAGCTGCATGAGTTCACTGATCTTAATCTCGTCCAGGCACTACGGCAGTTCCTGTGGAGCTTCC
GGCTACCCGGAGAGGCCCAGAAGATCGACCGGATGATGGAGGCGTTTGCCCAGCGATATTGTCAGTGCAA
TAATGGCGTGTTCCAGTCCACGGATACTTGTTACGTCCTCTCCTTTGCCATCATCATGTTGAACACCAGT
CTGCACAACCCCAATGTCAAAGATAAGCCCACTGTGGAGAGGTTCATTGCCATGAACCGAGGCATCAATG
ATGGGGGAGACCTGCCGGAGGAGCTCCTCCGGAATCTCTATGAGAGCATAAAAAATGAACCCTTTAAAAT
CCCAGAAGACGACGGGAATGACCTCACTCACACTTTCTTCAATCCAGACCGAGAAGGCTGGCTATTGAAA
CTCGGAGGTGGCAGGGTAAAGACTTGGAAGAGACGCTGGTTCATTCTGACTGACAACTGCCTTTACTACT
TTGAGTATACCACGGATAAGGAGCCCCGTGGAATCATCCCTTTAGAGAATCTGAGTATCCGGGAAGTGGA
GGACTCCAAAAAACCAAACTGCTTTGAGCTTTATATCCCCGACAATAAAGACCAAGTTATCAAGGCCTGC
AAGACCGAGGCTGACGGGCGGGTGGTGGAGGGGAACCACACTGTTTACCGGATCTCAGCTCCGACGCCCG
AGGAGAAGGAGGAGTGGATTAAGTGCATTAAAGCAGCCATCAGCAGGGACCCTTTCTACGAAATGCTCGC
AGCACGGAAAAAGAAGGTCTCCTCCACGAAGCGACACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001292019
ORF Size 1020 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001292019.1, NP_001278948.1
RefSeq Size 3329
RefSeq ORF 1020
Locus ID 9267
Gene Summary The protein encoded by this gene is a member of the PSCD family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This gene is highly expressed in natural killer and peripheral T cells, and regulates the adhesiveness of integrins at the plasma membrane of lymphocytes. A pseudogene of this gene has been defined on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Transcript Variant: This variant (4) uses an alternate 5'-terminal exon, differs in its 5' UTR, and uses a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Both variants 3 and 4 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.