GNB1 (NM_001282539) Human Untagged Clone

CAT#: SC335464

GNB1 (untagged) - Human guanine nucleotide binding protein (G protein), beta polypeptide 1 (GNB1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GNB1
• Synonyms: MRD42
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282539, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGTGAGCTTGACCAGTTACGGCAGGAGGCCGAGCAACTTAAGAACCAGATTCGAGACGCCAGGAAAG
  CATGTGCAGATGCAACTCTCTCTCAGATCACAAACAACATCGACCCAGTGGGAAGAATCCAAATGCGCAC
  GAGGAGGACACTGCGGGGGCACCTGGCCAAGATCTACGCCATGCACTGGGGCACAGACTCCAGGCTTCTC
  GTCAGTGCCTCGCAGGATGGTAAACTTATCATCTGGGACAGCTACACCACCAACAAGGTCCACGCCATCC
  CTCTGCGCTCCTCCTGGGTCATGACCTGTGCATATGCCCCTTCTGGGAACTATGTGGCCTGCGGTGGCCT
  GGATAACATTTGCTCCATTTACAATCTGAAAACTCGTGAGGGGAACGTGCGCGTGAGTCGTGAGCTGGCA
  GGACACACAGGTTACCTGTCCTGCTGCCGATTCCTGGATGACAATCAGATCGTCACCAGCTCTGGAGACA
  CCACGTGTGCCCTGTGGGACATCGAGACCGGCCAGCAGACGACCACGTTTACCGGACACACTGGAGATGT
  CATGAGCCTTTCTCTTGCTCCTGACACCAGACTGTTCGTCTCTGGTGCTTGTGATGCTTCAGCCAAACTC
  TGGGATGTGCGAGAAGGCATGTGCCGGCAGACCTTCACTGGCCACGAGTCTGACATCAATGCCATTTGCT
  TCTTTCCAAATGGCAATGCATTTGCCACTGGCTCAGACGACGCCACCTGCAGGCTGTTTGACCTTCGTGC
  TGACCAGGAGCTCATGACTTACTCCCATGACAACATCATCTGCGGGATCACCTCTGTCTCCTTCTCCAAG
  AGCGGGCGCCTCCTCCTTGCTGGGTACGACGACTTCAACTGCAACGTCTGGGATGCACTCAAAGCCGACC
  GGGCAGGTGTCTTGGCTGGGCATGACAACCGCGTCAGCTGCCTGGGCGTGACTGACGATGGCATGGCTGT
  GGCGACAGGGTCCTGGGATAGCTTCCTCAAGATCTGGAACTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282539
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282539.1, NP_001269468.1
• RefSeq Size: 3151 bp
• RefSeq ORF: 1023 bp
• Locus ID: 2782
• Cytogenetics: 1p36.33
• Protein Pathways: Chemokine signaling pathway, Taste transduction
• Gene Summary: 'Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]'
  Transcript Variant: This variant (2) differs in the 5' UTR. Both variants 1 and 2 encode the same isoform (1).