MICB (NM_001289161) Human Untagged Clone

CAT#: SC335469

MICB (untagged) - Human MHC class I polypeptide-related sequence B (MICB), transcript variant 3


  "NM_001289161" in other vectors (1)

Reconstitution Protocol

USD 350.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "MICB"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MICB
Synonyms PERB11.2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001289161, the custom clone sequence may differ by one or more nucleotides


ATGGGGCTGGGCCGGGTCCTGCTGTTTCTGGCCGTCGCCTTCCCTTTTGCACCCCCGGCAGCCGCCGCTG
AGCCCCACAGTCTTCGTTACAACCTCATGGTGCTGTCCCAGGATGGATCTGTGCAGTCAGGGTTTCTCGC
TGAGGGACATCTGGATGGTCAGCCCTTCCTGCGCTATGACAGGCAGAAACGCAGGGCAAAGCCCCAGGGA
CAGTGGGCAGAAAATGTCCTGGGAGCTAAGACCTGGGACACAGAGACCGAGGACTTGACAGAGAATGGGC
AAGACCTCAGGAGGACCCTGACTCATATCAAGGACCAGAAAGGAGTGCCCCAGTCCTCCAGAGCTCAGAC
CTTGGCTATGAACGTCACAAATTTCTGGAAGGAAGATGCCATGAAGACCAAGACACACTATCGCGCTATG
CAGGCAGACTGCCTGCAGAAACTACAGCGATATCTGAAATCCGGGGTGGCCATCAGGAGAACAGTGCCCC
CCATGGTGAATGTCACCTGCAGCGAGGTCTCAGAGGGCAACATCACCGTGACATGCAGGGCTTCCAGCTT
CTATCCCCGGAATATCACACTGACCTGGCGTCAGGATGGGGTATCTTTGAGCCACAACACCCAGCAGTGG
GGGGATGTCCTGCCTGATGGGAATGGAACCTACCAGACCTGGGTGGCCACCAGGATTCGCCAAGGAGAGG
AGCAGAGGTTCACCTGCTACATGGAACACAGCGGGAATCACGGCACTCACCCTGTGCCCTCTGGGAAGGC
GCTGGTGCTTCAGAGTCAACGGACAGACTTTCCATATGTTTCTGCTGCTATGCCATGTTTTGTTATTATT
ATTATTCTCTGTGTCCCTTGTTGCAAGAAGAAAACATCAGCGGCAGAGGGTCCAGAGCTTGTGAGCCTGC
AGGTCCTGGATCAACACCCAGTTGGGACAGGAGACCACAGGGATGCAGCACAGCTGGGATTTCAGCCTCT
GATGTCAGCTACTGGGTCCACTGGTTCCACTGAGGGCACCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001289161
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289161.1, NP_001276090.1
RefSeq Size 2396 bp
RefSeq ORF 1023 bp
Locus ID 4277
Cytogenetics 6p21.33
Protein Families Druggable Genome
Protein Pathways Natural killer cell mediated cytotoxicity
Gene Summary 'This gene encodes a heavily glycosylated protein which is a ligand for the NKG2D type II receptor. Binding of the ligand activates the cytolytic response of natural killer (NK) cells, CD8 alphabeta T cells, and gammadelta T cells which express the receptor. This protein is stress-induced and is similar to MHC class I molecules; however, it does not associate with beta-2-microglobulin or bind peptides. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]'
Transcript Variant: This variant (3) contains an alternate in-frame splice site in the 5' coding region, compared to variant 1. It encodes isoform 3, which is shorter than isofom 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.