NRF1 (NM_001293164) Human Untagged Clone

CAT#: SC335482

NRF1 (untagged) - Human nuclear respiratory factor 1 (NRF1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NRF1
• Synonyms: ALPHA-PAL
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001293164, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATCCTGGAAGACCTGGAGTCTGCTCTGGCAGAACACGCCCCTGCGCCACAGGAGGTTAACTCAGAAC
  TGCCGCCTCTCACCATCGACGGAATTCCAGTCTCTGTGGACAAAATGACCCAGGCCCAGCTTCGGGCATT
  TATCCCAGAGATGCTCAAGTACTCTACAGGTCGGGGAAAACCAGGCTGGGGGAAAGAAAGCTGCAAGCCC
  ATCTGGTGGCCTGAAGATATCCCCTGGGCAAATGTCCGGAGTGATGTCCGCACAGAAGAGCAAAAGCAGA
  GGGTTTCATGGACCCAGGCACTACGGACCATAGTTAAAAACTGTTATAAACAGCATGGGCGGGAAGACCT
  TTTGTATGCCTTTGAAGATCAGCAAACGCAAACACAGGCCACAGCCACACATAGTATAGCTCATCTTGTA
  CCATCACAGACTGTAGTCCAGACTTTTAGTAACCCTGATGGCACTGTCTCACTTATCCAGGTTGGTACGG
  GGGCAACAGTAGCCACATTGGCTGATGCTTCAGAATTGCCAACCACGGTCACCGTTGCCCAAGTGAATTA
  TTCTGCCGTGGCTGATGGAGAGGTGGAACAAAATTGGGCCACGTTACAGGGAGGTGAGATGACCATCCAG
  ACGACGCAAGCATCAGAGGCCACCCAGGCGGTGGCATCGTTGGCAGAGGCCGCAGTGGCAGCTTCTCAGG
  AGATGCAGCAGGGAGCTACAGTCACTATGGCGCTTAACAGCGAAGCTGCCGCCCATGCTGTCGCCACCCT
  GGCTGAGGCCACCTTACAAGGTGGGGGACAGATCGTCTTGTCTGGGGAAACCGCAGCAGCCGTCGGAGCA
  CTTACTGGAGTCCAAGATGCTAATGGCCTGGTCCAGATCCCTGTGAGCATGTACCAGACTGTGGTGACCA
  GCCTCGCCCAGGGCAACGGACCAGTGCAGGTGGCCATGGCCCCTGTGACCACCAGGATATCAGACAGCGC
  AGTCACCATGGACGGCCAAGCTGTGGAGGTGGTGACATTGGAACAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001293164
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001293164.1, NP_001280093.1
• RefSeq Size: 3440 bp
• RefSeq ORF: 1029 bp
• Locus ID: 4899
• Cytogenetics: 7q32.2
• Protein Families: Transcription Factors
• Protein Pathways: Huntington's disease
• Gene Summary: 'This gene encodes a protein that homodimerizes and functions as a transcription factor which activates the expression of some key metabolic genes regulating cellular growth and nuclear genes required for respiration, heme biosynthesis, and mitochondrial DNA transcription and replication. The protein has also been associated with the regulation of neurite outgrowth. Alternative splicing results in multiple transcript variants. Confusion has occurred in bibliographic databases due to the shared symbol of NRF1 for this gene and for "nuclear factor (erythroid-derived 2)-like 1" which has an official symbol of NFE2L1. [provided by RefSeq, May 2014]'
  Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the coding region, and initiates translation at a downstream start codon, compared to variant 3. The encoded protein (isoform 3) is shorter, compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.