NRF1 (NM_001293164) Human Untagged Clone

CAT#: SC335482

NRF1 (untagged) - Human nuclear respiratory factor 1 (NRF1), transcript variant 4


  "NM_001293164" in other vectors (1)

Reconstitution Protocol

USD 350.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "NRF1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NRF1
Synonyms ALPHA-PAL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001293164, the custom clone sequence may differ by one or more nucleotides


ATGATCCTGGAAGACCTGGAGTCTGCTCTGGCAGAACACGCCCCTGCGCCACAGGAGGTTAACTCAGAAC
TGCCGCCTCTCACCATCGACGGAATTCCAGTCTCTGTGGACAAAATGACCCAGGCCCAGCTTCGGGCATT
TATCCCAGAGATGCTCAAGTACTCTACAGGTCGGGGAAAACCAGGCTGGGGGAAAGAAAGCTGCAAGCCC
ATCTGGTGGCCTGAAGATATCCCCTGGGCAAATGTCCGGAGTGATGTCCGCACAGAAGAGCAAAAGCAGA
GGGTTTCATGGACCCAGGCACTACGGACCATAGTTAAAAACTGTTATAAACAGCATGGGCGGGAAGACCT
TTTGTATGCCTTTGAAGATCAGCAAACGCAAACACAGGCCACAGCCACACATAGTATAGCTCATCTTGTA
CCATCACAGACTGTAGTCCAGACTTTTAGTAACCCTGATGGCACTGTCTCACTTATCCAGGTTGGTACGG
GGGCAACAGTAGCCACATTGGCTGATGCTTCAGAATTGCCAACCACGGTCACCGTTGCCCAAGTGAATTA
TTCTGCCGTGGCTGATGGAGAGGTGGAACAAAATTGGGCCACGTTACAGGGAGGTGAGATGACCATCCAG
ACGACGCAAGCATCAGAGGCCACCCAGGCGGTGGCATCGTTGGCAGAGGCCGCAGTGGCAGCTTCTCAGG
AGATGCAGCAGGGAGCTACAGTCACTATGGCGCTTAACAGCGAAGCTGCCGCCCATGCTGTCGCCACCCT
GGCTGAGGCCACCTTACAAGGTGGGGGACAGATCGTCTTGTCTGGGGAAACCGCAGCAGCCGTCGGAGCA
CTTACTGGAGTCCAAGATGCTAATGGCCTGGTCCAGATCCCTGTGAGCATGTACCAGACTGTGGTGACCA
GCCTCGCCCAGGGCAACGGACCAGTGCAGGTGGCCATGGCCCCTGTGACCACCAGGATATCAGACAGCGC
AGTCACCATGGACGGCCAAGCTGTGGAGGTGGTGACATTGGAACAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001293164
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001293164.1, NP_001280093.1
RefSeq Size 3440 bp
RefSeq ORF 1029 bp
Locus ID 4899
Cytogenetics 7q32.2
Protein Families Transcription Factors
Protein Pathways Huntington's disease
Gene Summary 'This gene encodes a protein that homodimerizes and functions as a transcription factor which activates the expression of some key metabolic genes regulating cellular growth and nuclear genes required for respiration, heme biosynthesis, and mitochondrial DNA transcription and replication. The protein has also been associated with the regulation of neurite outgrowth. Alternative splicing results in multiple transcript variants. Confusion has occurred in bibliographic databases due to the shared symbol of NRF1 for this gene and for "nuclear factor (erythroid-derived 2)-like 1" which has an official symbol of NFE2L1. [provided by RefSeq, May 2014]'
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the coding region, and initiates translation at a downstream start codon, compared to variant 3. The encoded protein (isoform 3) is shorter, compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.