PHF7 (NM_001278221) Human Untagged Clone

CAT#: SC335483

PHF7 (untagged) - Human PHD finger protein 7 (PHF7), transcript variant 2


  "NM_001278221" in other vectors (1)

Reconstitution Protocol

USD 350.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "PHF7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PHF7
Synonyms HSPC045; HSPC226; NYD-SP6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278221, the custom clone sequence may differ by one or more nucleotides


ATGAAGACTGTAAAAGAAAAGAAGGAATGCCAGAGATTGAGAAAATCTGCCAAGACTAGGAGGGTAACCC
AGAGGAAACCGTCTTCAGGGCCTGTTTGCTGGCTATGCCTTCGAGAACCTGGGGATCCCGAAAAATTAGG
GGAATTTCTTCAGAAAGACAATATCAGCGTGCATTATTTCTGTCTTATCTTATCTAGTAAGCTGCCTCAG
AGGGGCCAGTCCAACAGAGGCTTCCATGGATTTCTGCCTGAAGACATCAAAAAGGAGGCAGCCCGGGCTT
CTAGGAAGATCTGCTTTGTGTGCAAGAAAAAGGGAGCTGCTATCAACTGCCAGAAGGATCAGTGCCTCAG
AAACTTCCATCTGCCTTGTGGCCAAGAAAGGGGTTGCCTTTCACAATTTTTTGGAGAGTACAAATCATTT
TGTGACAAACATCGCCCAACACAGAACATCCAACATGGGCATGTGGGGGAGGAAAGCTGCATCTTATGTT
GTGAAGACTTATCCCAACAGAGTGTTGAGAACATCCAGAGCCCGTGTTGTAGTCAAGCCATCTACCACCG
CAAGTGCATACAGAAATATGCCCACACATCAGCAAAGCATTTCTTCAAATGTCCACAGTGTAACAATCGA
AAAGAGTTTCCTCAAGAAATGCTGAGAATGGGAATTCATATTCCAGACAGGAGGTGGTGCCTCATTCTGT
GTGCTACATGCGGATCCCACGGAACCCACAGGGACTGCTCCTCTCTTAGATCTAACAGTAAGAAATGGGA
GTGTGAGGAGTGTTCACCTGCTGCAGCCACAGACTACATACCTGAAAACTCAGGGGACATCCCTTGCTGC
AGCAGCACCTTCCACCCTGAGGAACATTTCTGCAGAGACAACACCTTGGAAGAGAATCCGGGCCTTTCTT
GGACTGATTGGCCAGAACCTTCCTTATTAGAAAAGCCAGAGTCCTCTCGTGGCAGGAGGAGCTACTCCTG
GAGGTCCAAGGGTGTCAGAATCACTAACAGCTGCAAAAAATCCAAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001278221
ORF Size 1029 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001278221.2, NP_001265150.1
RefSeq Size 2176
RefSeq ORF 1029
Locus ID 51533
Protein Families Druggable Genome, Transcription Factors
Gene Summary Spermatogenesis is a complex process regulated by extracellular and intracellular factors as well as cellular interactions among interstitial cells of the testis, Sertoli cells, and germ cells. This gene is expressed in the testis in Sertoli cells but not germ cells. The protein encoded by this gene contains plant homeodomain (PHD) finger domains, also known as leukemia associated protein (LAP) domains, believed to be involved in transcriptional regulation. The protein, which localizes to the nucleus of transfected cells, has been implicated in the transcriptional regulation of spermatogenesis. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. It encodes isoform 2 which is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.