Sex Hormone Binding Globulin (SHBG) (NM_001289114) Human Untagged Clone

CAT#: SC335488

SHBG (untagged) - Human sex hormone-binding globulin (SHBG), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SHBG
• Synonyms: ABP; SBP; TEBG
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001289114, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACCTTTGACCTCACCAAGATCACAAAAACCTCCTCCTCCTTTGAGGTTCGAACCTGGGACCCAGAGG
  GAGTGATTTTTTATGGGGATACCAACCCTAAGGATGACTGGTTTATGCTGGGACTTCGAGACGGCAGGCC
  TGAGATCCAACTGCACAATCACTGGGCCCAGCTTACGGTGGGTGCTGGACCACGGCTGGATGATGGGAGA
  TGGCACCAGGTGGAAGTCAAGATGGAGGGGGACTCTGTGCTGCTGGAGGTGGATGGGGAGGAGGTGCTGC
  GCCTGAGACAGGTCTCTGGGCCCCTGACCAGCAAACGCCATCCCATCATGAGGATTGCGCTTGGGGGGCT
  GCTCTTCCCCGCTTCCAACCTTCGGTTGCCGCTGGTTCCTGCCCTGGATGGCTGCCTGCGCCGGGATTCC
  TGGCTGGACAAACAGGCCGAGATCTCAGCATCTGCCCCCACTAGCCTCAGAAGCTGTGATGTAGAATCAA
  ATCCCGGGATATTTCTCCCTCCAGGGACTCAGGCAGAATTCAATCTCCGAGACATTCCCCAGCCTCATGC
  AGAGCCCTGGGCCTTCTCTTTGGACCTGGGACTCAAGCAGGCAGCAGGCTCAGGCCACCTCCTTGCTCTT
  GGGACACCAGAGAACCCATCTTGGCTCAGTCTCCACCTCCAAGATCAAAAGGTGGTGTTGTCTTCTGGGT
  CGGGGCCAGGGCTGGATCTGCCCCTGGTCTTGGGACTCCCTCTTCAGCTGAAGCTGAGTATGTCCAGGGT
  GGTCTTGAGCCAAGGGTCGAAGATGAAGGCCCTTGCCCTGCCTCCCTTAGGCCTGGCTCCCCTCCTTAAC
  CTCTGGGCCAAGCCTCAAGGGCGTCTCTTCCTGGGGGCTTTACCAGGAGAAGACTCTTCCACCTCTTTTT
  GCCTGAATGGCCTTTGGGCACAAGGTCAGAGGCTGGATGTGGACCAGGCCCTGAACAGAAGCCATGAGAT
  CTGGACTCACAGCTGCCCCCAGAGCCCAGGCAATGGCACTGACGCTTCCCATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001289114
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001289114.1, NP_001276043.1
• RefSeq Size: 1189 bp
• RefSeq ORF: 1035 bp
• Locus ID: 6462
• Cytogenetics: 17p13.1
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: 'This gene encodes a steroid binding protein that was first described as a plasma protein secreted by the liver but is now thought to participate in the regulation of steroid responses. The encoded protein transports androgens and estrogens in the blood, binding each steroid molecule as a dimer formed from identical or nearly identical monomers. Polymorphisms in this gene have been associated with polycystic ovary syndrome and type 2 diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]'
  Transcript Variant: This variant (6) differs in the 5' UTR, lacks part of the 5' coding region, and uses a downstream start codon, compared to variant 1. The encoded isoform (5) has a shorter N-terminus, compared to isoform 1. Both variants 5 and 6 encode the same isoform.