PPP1R7 (NM_001282412) Human Untagged Clone

CAT#: SC335491

PPP1R7 (untagged) - Human protein phosphatase 1, regulatory subunit 7 (PPP1R7), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPP1R7
• Synonyms: SDS22
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282412, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTTGACAGGCGGGTCGAGTCTGAAGAATCCGGCGATGAAGAAGGGAAGAAACACAGCAGTGGCATCG
  TGGCCGACCTCAGTGAACAGAGCCTGAAGGATGGGGAGGAGCGGGGGGAGGAGGACCCAGAAGAAGAACA
  TGAGCTGCCTGTGGACATGGAAACCATCAACCTGGACAGAGATGCAGAGGATGTTGATTTGAATCACTAT
  CGCATAGGGAAGATTGAAGGATTTGAGGTACTGAAGAAAGTGAAGACTCTCTGCCTCCGCCAAAATTTAA
  TTAAATGCATTGAGAATCTGGAGGAGCTACAGAGTCTTCGAGAGCTGGATCTTTACGACAACCAGATCAA
  GAAGATTGAGAATCTGGAGGCGCTAACAGAGCTGGAGATTCTAGATATTTCTTTTAATCTGCTGAGAAAC
  ATCGAAGGGGTTGACAAGTTGACACGACTGAAAAAACTCTTCTTGGTCAACAATAAAATCAGTAAAATTG
  AGAACTTAAGCAACTTACATCAACTACAGATGCTAGAGCTGGGATCTAACCGCATCCGGGCAATCGAAAA
  TATCGACACCTTAACCAACCTGGAGAGTTTGTTTTTGGGGAAAAACAAAATTACTAAACTTCAGAACCTG
  GATGCGCTCACCAACCTGACAGTCCTCAGTATGCAGAGCAACCGGCTGACCAAGATCGAGGGTCTGCAGA
  ACCTGGTGAACCTGCGGGAGCTGTACCTTAGCCACAATGGCATCGAGGTCATCGAGGGCCTGGAGAACAA
  TAACAAACTCACGATGTTGGACATTGCATCAAATAGAATCAAAAAGATTGAAAATATCAGCCATCTAACA
  GAGCTGCAAGAGTTCTGGATGAACGACAATCTCCTTGAGAGCTGGAGCGACCTCGACGAGCTGAAGGGAG
  CCAGGAGCCTGGAGACAGTGTACCTGGAGCGGAACCCCTTGCAGAAGGACCCCCAGTACCGGCGGAAGGT
  CATGCTCGCCCTCCCCTCCGTGCGGCAGATCGATGCCACGTTCGTCAGGTTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282412
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282412.1, NP_001269341.1
• RefSeq Size: 2007 bp
• RefSeq ORF: 1035 bp
• Locus ID: 5510
• Cytogenetics: 2q37.3
• Protein Families: Druggable Genome, Phosphatase
• Gene Summary: 'This gene encodes a protein subunit that regulates the activity of the serine/threonine phosphatase, protein phosphatase-1. The encoded protein is required for completion of the mitotic cycle and for targeting protein phosphatase-1 to mitotic kinetochores. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]'
  Transcript Variant: This variant (5) uses an alternate 5' structure, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon compared to variant 1. The encoded protein (isoform 5) is shorter and has a distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.