MVK (NM_001301182) Human Untagged Clone

CAT#: SC335492

MVK (untagged) - Human mevalonate kinase (MVK), transcript variant 3


  "NM_001301182" in other vectors (1)

Reconstitution Protocol

USD 350.00

2 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MVK
Synonyms LRBP; MK; MVLK; POROK3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301182, the custom clone sequence may differ by one or more nucleotides


ATGTTGTCAGAAGTCCTACTGGTGTCTGCTCCGGGGAAAGTCATCCTTCATGGAGAACATGCCGTGGTAC
ATGGCAAGGTAGCACTGGCTGTATCCTTGAACTTGAGAACATTCCTCCGGCTTCAACCCCACAGCAATGG
GAAAGTGGACCTCAGCTTACCCAACATTGGTATCAAGCGGGCCTGGGATGTGGCCAGGCTTCAGTCACTG
GACACAAGCTTTCTGGAGCAAGGTGATGTCACAACACCCACCTCAGAGCAAGTGGAGAAGCTAAAGGAGG
TTGCAGGCTTGCCTGACGACTGTGCTGTCACCGAGCGCCTGGCTGTGCTGGCCTTTCTTTACTTATACCT
GTCCATCTGCCGGAAGCAGAGGTGGACCAAGGAGGATTTGGAGCTAATTAACAAGTGGGCCTTCCAAGGG
GAGAGAATGATTCACGGGAACCCCTCCGGAGTGGACAATGCTGTCAGCACCTGGGGAGGAGCCCTCCGAT
ACCATCAAGGGAAGATTTCATCCTTAAAGAGGTCGCCAGCTCTCCAGATCCTGCTGACCAACACCAAAGT
CCCTCGCAATACCAGGGCCCTTGTGGCTGGCGTCAGAAACAGGCTGCTCAAGTTCCCAGAGATCGTGGCC
CCCCTCCTGACCTCAATAGATGCCATCTCCCTGGAGTGTGAGCGCGTGCTGGGAGAGATGGGGGAAGCCC
CAGCCCCGGAGCAGTACCTCGTGCTGGAAGAGCTCATTGACATGAACCAGCACCATCTGAATGCCCTCGG
CGTGGGCCACGCCTCTCTGGACCAGCTCTGCCAGGTGACCAGGGCCCGCGGACTTCACAGCAAGCTGACT
GGCGCAGGCGGTGGTGGCTGTGGCATCACACTCCTCAAGCCAGGGCTGGAGCAGCCAGAAGTGGAGGCCA
CGAAGCAGGCCCTGACCAGCTGTGGCTTTGACTGCTTGGAAACCAGCATCGGTGCCCCCGGCGTCTCCAT
CCACTCAGCCACCTCCCTGGACAGCCGAGTCCAGCAAGCCCTGGATGGCCTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001301182
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301182.1, NP_001288111.1
RefSeq Size 1928 bp
RefSeq ORF 1035 bp
Locus ID 4598
Cytogenetics 12q24.11
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Terpenoid backbone biosynthesis
Gene Summary 'This gene encodes the peroxisomal enzyme mevalonate kinase. Mevalonate is a key intermediate, and mevalonate kinase a key early enzyme, in isoprenoid and sterol synthesis. Mevalonate kinase deficiency caused by mutation of this gene results in mevalonic aciduria, a disease characterized psychomotor retardation, failure to thrive, hepatosplenomegaly, anemia and recurrent febrile crises. Defects in this gene also cause hyperimmunoglobulinaemia D and periodic fever syndrome, a disorder characterized by recurrent episodes of fever associated with lymphadenopathy, arthralgia, gastrointestinal dismay and skin rash. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]'
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5' coding region compared to variant 1. The encoded isoform (b) is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.