CEBP Alpha (CEBPA) (NM_001287435) Human Untagged Clone
CAT#: SC335494
CEBPA (untagged) - Human CCAAT/enhancer binding protein (C/EBP), alpha (CEBPA), transcript variant 1
"NM_001287435" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CEBPA |
Synonyms | C/EBP-alpha; CEBP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001287435, the custom clone sequence may differ by one or more nucleotides
ATGAGCAGCCACCTGCAGAGCCCCCCGCACGCGCCCAGCAGCGCCGCCTTCGGCTTTCCCCGGGGCGCGG GCCCCGCGCAGCCTCCCGCCCCACCTGCCGCCCCGGAGCCGCTGGGCGGCATCTGCGAGCACGAGACGTC CATCGACATCAGCGCCTACATCGACCCGGCCGCCTTCAACGACGAGTTCCTGGCCGACCTGTTCCAGCAC AGCCGGCAGCAGGAGAAGGCCAAGGCGGCCGTGGGCCCCACGGGCGGCGGCGGCGGCGGCGACTTTGACT ACCCGGGCGCGCCCGCGGGCCCCGGCGGCGCCGTCATGCCCGGGGGAGCGCACGGGCCCCCGCCCGGCTA CGGCTGCGCGGCCGCCGGCTACCTGGACGGCAGGCTGGAGCCCCTGTACGAGCGCGTCGGGGCGCCGGCG CTGCGGCCGCTGGTGATCAAGCAGGAGCCCCGCGAGGAGGATGAAGCCAAGCAGCTGGCGCTGGCCGGCC TCTTCCCTTACCAGCCGCCGCCGCCGCCGCCGCCCTCGCACCCGCACCCGCACCCGCCGCCCGCGCACCT GGCCGCCCCGCACCTGCAGTTCCAGATCGCGCACTGCGGCCAGACCACCATGCACCTGCAGCCCGGTCAC CCCACGCCGCCGCCCACGCCCGTGCCCAGCCCGCACCCCGCGCCCGCGCTCGGTGCCGCCGGCCTGCCGG GCCCTGGCAGCGCGCTCAAGGGGCTGGGCGCCGCGCACCCCGACCTCCGCGCGAGTGGCGGCAGCGGCGC GGGCAAGGCCAAGAAGTCGGTGGACAAGAACAGCAACGAGTACCGGGTGCGGCGCGAGCGCAACAACATC GCGGTGCGCAAGAGCCGCGACAAGGCCAAGCAGCGCAACGTGGAGACGCAGCAGAAGGTGCTGGAGCTGA CCAGTGACAATGACCGCCTGCGCAAGCGGGTGGAACAGCTGAGCCGCGAACTGGACACGCTGCGGGGCAT CTTCCGCCAGCTGCCAGAGAGCTCCTTGGTCAAGGCCATGGGCAACTGCGCGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001287435 |
ORF Size | 1035 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001287435.1, NP_001274364.1 |
RefSeq Size | 2631 |
RefSeq ORF | 1035 |
Locus ID | 1050 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS |
Protein Pathways | Acute myeloid leukemia, Pathways in cancer |
Gene Summary | This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain and recognizes the CCAAT motif in the promoters of target genes. The encoded protein functions in homodimers and also heterodimers with CCAAT/enhancer-binding proteins beta and gamma. Activity of this protein can modulate the expression of genes involved in cell cycle regulation as well as in body weight homeostasis. Mutation of this gene is associated with acute myeloid leukemia. The use of alternative in-frame non-AUG (GUG) and AUG start codons results in protein isoforms with different lengths. Differential translation initiation is mediated by an out-of-frame, upstream open reading frame which is located between the GUG and the first AUG start codons. [provided by RefSeq, Dec 2013] Transcript Variant: This variant (1) can initiate translation from an upstream non-AUG (GUG) site, and also from three downstream, in-frame AUG sites. The isoform (d) represented in this RefSeq results from translation initiation at the second AUG start codon. Isoform d has a shorter N-terminus, compared to isoform c. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237600 | CEBPA (myc-DDK-tagged) - Human CCAAT/enhancer binding protein (C/EBP), alpha (CEBPA), transcript variant 1 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review