ZNF2 (NM_001291604) Human Untagged Clone

CAT#: SC335500

ZNF2 (untagged) - Human zinc finger protein 2 (ZNF2), transcript variant 4


  "NM_001291604" in other vectors (1)

Reconstitution Protocol

USD 350.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "ZNF2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZNF2
Synonyms A1-5; Zfp661; ZNF661
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001291604, the custom clone sequence may differ by one or more nucleotides


ATGCTGGAGAACTATAACAGCATTGTGTCATTGGACTGGGAAACTAAGCCTGAGATTCACGATGCTTCAG
ACAAAAAATCAGAAGGATCATTGAGGGAATGCCTTGGAAGGCAAAGTCCTCTGTGTCCTAAATTTGAAGT
TCATACACCCAATGGCAGGATGGGAACAGAAAAGCAAAGCCCTTCAGGGGAGACTCGTAAGAAATCCCTC
TCCCGGGACAAAGGCTTGCGGCGACGGTCAGCCCTGTCCAGGGAAATTCTCACTAAAGAGAGACACCAGG
AATGCAGTGACTGTGGGAAGACCTTTTTTGACCACTCATCCCTCACCCGCCATCAGAGGACTCACACTGG
GGAGAAGCCCTACGACTGCCGCGAGTGTGGGAAAGCCTTCAGCCACAGGAGCAGCCTCAGCAGACATCTG
ATGTCACACACTGGGGAGAGCCCCTACGAGTGCAGTGTGTGCTCAAAAGCCTTCTTTGACCGTTCGTCCC
TAACTGTCCATCAGCGAATTCACACTGGAGAGAAACCCTTTCAGTGCAACGAGTGTGGAAAAGCCTTTTT
TGACCGTTCATCCCTTACTCGACACCAGAGAATTCACACTGGAGAAAGTCCTTATGAATGTCATCAGTGT
GGGAAAGCCTTTAGCCAGAAAAGTATTCTTACTCGCCATCAGCTAATCCACACTGGCAGGAAGCCTTATG
AGTGTAACGAGTGCGGGAAAGCTTTCTATGGTGTCTCGTCTCTGAATAGACATCAGAAAGCTCATGCTGG
GGACCCTCGCTATCAGTGTAACGAGTGTGGCAAAGCTTTCTTTGACCGCTCATCCCTTACACAGCATCAG
AAGATCCACACTGGAGACAAGCCATATGAATGCAGCGAATGCGGGAAAGCCTTTAGCCAGCGGTGCCGGC
TCACGCGGCATCAGCGTGTCCACACGGGAGAGAAGCCCTTTGAATGCACTGTGTGTGGGAAAGTTTTCAG
TTCAAAATCTTCTGTTATTCAACATCAACGGCGTTACGCCAAACAGGGAATAGACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001291604
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291604.1, NP_001278533.1
RefSeq Size 3794 bp
RefSeq ORF 1038 bp
Locus ID 7549
Cytogenetics 2q11.1
Protein Families Transcription Factors
Gene Summary 'The protein encoded by this gene belongs to the C2H2-type zinc-finger protein family. The exact function of this gene is not known, however, zinc-finger proteins are known to interact with DNA and function as transcription regulators. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]'
Transcript Variant: This variant (4) lacks two alternate exons in the 5' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (d) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.