MICB (NM_001289160) Human Untagged Clone
CAT#: SC335544
MICB (untagged) - Human MHC class I polypeptide-related sequence B (MICB), transcript variant 2
"NM_001289160" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MICB |
Synonyms | PERB11.2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001289160, the custom clone sequence may differ by one or more nucleotides
ATGGTGCTGTCCCAGGATGGATCTGTGCAGTCAGGGTTTCTCGCTGAGGGACATCTGGATGGTCAGCCCT TCCTGCGCTATGACAGGCAGAAACGCAGGGCAAAGCCCCAGGGACAGTGGGCAGAAAATGTCCTGGGAGC TAAGACCTGGGACACAGAGACCGAGGACTTGACAGAGAATGGGCAAGACCTCAGGAGGACCCTGACTCAT ATCAAGGACCAGAAAGGAGGCTTGCATTCCCTCCAGGAGATTAGGGTCTGTGAGATCCATGAAGACAGCA GCACCAGGGGCTCCCGGCATTTCTACTACGATGGGGAGCTCTTCCTCTCCCAAAACCTGGAGACTCAAGA ATCGACAGTGCCCCAGTCCTCCAGAGCTCAGACCTTGGCTATGAACGTCACAAATTTCTGGAAGGAAGAT GCCATGAAGACCAAGACACACTATCGCGCTATGCAGGCAGACTGCCTGCAGAAACTACAGCGATATCTGA AATCCGGGGTGGCCATCAGGAGAACAGTGCCCCCCATGGTGAATGTCACCTGCAGCGAGGTCTCAGAGGG CAACATCACCGTGACATGCAGGGCTTCCAGCTTCTATCCCCGGAATATCACACTGACCTGGCGTCAGGAT GGGGTATCTTTGAGCCACAACACCCAGCAGTGGGGGGATGTCCTGCCTGATGGGAATGGAACCTACCAGA CCTGGGTGGCCACCAGGATTCGCCAAGGAGAGGAGCAGAGGTTCACCTGCTACATGGAACACAGCGGGAA TCACGGCACTCACCCTGTGCCCTCTGGGAAGGCGCTGGTGCTTCAGAGTCAACGGACAGACTTTCCATAT GTTTCTGCTGCTATGCCATGTTTTGTTATTATTATTATTCTCTGTGTCCCTTGTTGCAAGAAGAAAACAT CAGCGGCAGAGGGTCCAGAGCTTGTGAGCCTGCAGGTCCTGGATCAACACCCAGTTGGGACAGGAGACCA CAGGGATGCAGCACAGCTGGGATTTCAGCCTCTGATGTCAGCTACTGGGTCCACTGGTTCCACTGAGGGC ACCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289160 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001289160.1, NP_001276089.1 |
RefSeq Size | 2426 bp |
RefSeq ORF | 1056 bp |
Locus ID | 4277 |
Cytogenetics | 6p21.33 |
Protein Families | Druggable Genome |
Protein Pathways | Natural killer cell mediated cytotoxicity |
Gene Summary | 'This gene encodes a heavily glycosylated protein which is a ligand for the NKG2D type II receptor. Binding of the ligand activates the cytolytic response of natural killer (NK) cells, CD8 alphabeta T cells, and gammadelta T cells which express the receptor. This protein is stress-induced and is similar to MHC class I molecules; however, it does not associate with beta-2-microglobulin or bind peptides. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]' Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream start codon, compared to variant 1. It encodes isoform 2, which has a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237650 | MICB (myc-DDK-tagged) - Human MHC class I polypeptide-related sequence B (MICB), transcript variant 2 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review