ALDH3B1 (NM_001290058) Human Untagged Clone

CAT#: SC335545

ALDH3B1 (untagged) - Human aldehyde dehydrogenase 3 family, member B1 (ALDH3B1), transcript variant 4


  "NM_001290058" in other vectors (1)

Reconstitution Protocol

USD 360.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "ALDH3B1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ALDH3B1
Synonyms ALDH4; ALDH7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001290058, the custom clone sequence may differ by one or more nucleotides


ATGGACCCCCTTGGGGACACGCTGCGGCGACTGCGGGAGGCCTTCCACGCGGGGCGCACGCGGCCAGCTG
AGTTCCGGGCTGCGCAGCTCCAAGGCCTGGGCCGCTTCCTGCAAGAAAACAAGCAGCTTCTGCACGACGC
ACTGGCCCAGGACCTGCACAAGTCAGCCTTCGAGTCGGAGGTGTCTGAGGTTGCCATCAGCCAGGGCGAG
GTCACCCTGGCCCTCAGGAACCTCCGGGCCTGGATGAAGGACGAGCGTGTGCCCAAGAACCTGGCCACGC
AGCTGGACTCCGCCTTCATCCGGAAGGAGCCCTTTGGCCTGGTCCTCATCATTGCGCCCTGGAACTATCC
GCTGAACCTGACGCTGGTGCCCCTCGTGGGAGCCCTCGCTGCAGGGAACTGTGTGGTGCTGAAGCCATCG
GAGATTAGCAAGAACGTCGAGAAGATCCTGGCCGAGGTGCTGCCCCAATACGTGGACCAGAGCTCCCCAA
ACCTGGGCCGCATCATCAACCAGAAACAGTTCCAGCGGCTGCGGGCATTGCTGGGCTGCGGCCGTGTGGC
CATTGGGGGCCAGAGCGATGAGAGCGATCGCTACATCGCCCCCACGGTGCTGGTGGATGTGCAGGAGATG
GAGCCTGTGATGCAGGAGGAGATCTTCGGGCCCATCCTGCCCATCGTGAACGTGCAGAGCTTGGACGAGG
CCATCGAGTTCATCAACCGGCGGGAGAAGCCCCTGGCCCTGTACGCCTTCTCCAACAGCAGCCAGGTGGT
CAAGCGGGTGCTGACCCAGACCAGCAGCGGGGGCTTCTGTGGGAACGACGGCTTCATGCACATGACCCTG
GCCAGCCTGCCTTTTGGAGGAGTGGGTGCCAGTGGGATGGGCCGGTACCATGGCAAGTTCTCCTTCGACA
CCTTCTCCCACCATCGCGCCTGCCTCCTGCGCAGCCCGGGGATGGAGAAGCTCAACGCCCTCCGCTACCC
GCCGCAATCGCCGCGCCGCCTGAGGATGCTGCTGGTGGCCATGGAGGCCCAAGGCTGCAGCTGCACACTG
CTCTGA


Restriction Sites AscI-MluI     
ACCN NM_001290058
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290058.1, NP_001276987.1
RefSeq Size 2505 bp
RefSeq ORF 1056 bp
Locus ID 221
Cytogenetics 11q13.2
Protein Families Druggable Genome
Protein Pathways Drug metabolism - cytochrome P450, Glycolysis / Gluconeogenesis, Histidine metabolism, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Phenylalanine metabolism, Tyrosine metabolism
Gene Summary 'This gene encodes a member of the aldehyde dehydrogenase protein family. Aldehyde dehydrogenases are a family of isozymes that may play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. The encoded protein is able to oxidize long-chain fatty aldehydes in vitro, and may play a role in protection from oxidative stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]'
Transcript Variant: This variant (4) lacks an exon and uses an alternate in-frame splice site in the central coding region, compared to variant 1. The encoded isoform (c) is shorter, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.