FGFR1 Oncogene Partner (FGFR1OP) (NM_001278690) Human Untagged Clone

CAT#: SC335546

FGFR1OP (untagged) - Human FGFR1 oncogene partner (FGFR1OP), transcript variant 3


  "NM_001278690" in other vectors (1)

Reconstitution Protocol

USD 360.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "FGFR1OP"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FGFR1OP
Synonyms FOP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278690, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCGACGGCGGCCGCAGTGGTGGCCGAGGAGGACACGGAGCTGCGGGACCTGCTGGTGCAGACGC
TGGAGAACAGCGGGGTCCTGAACCGCATCAAGGCTGAACTCCGAGCAGCTGTGTTTTTAGCACTAGAGGA
GCAAGAAAAAGTAGAGAACAAAACTCCTTTAGTTAATGAGAGCCTGAAAAAGTTTTTAAATACCAAAGAC
GGTCGTTTAGTGGCTAGTCTTGTTGCAGAATTTCTTCAGTTTTTTAACCTTGACTTTACTTTGGCTGTTT
TTCAACCTGAAACTAGCACACTGCAAGGTCTCGAAGGTCGAGAGAATTTAGCCCGAGATTTAGGTATAAT
TGAAGCAGAAGGTACTGTGGGTGGACCCTTATTATTAGAAGTGATCAGGCGCTGTCAACAGAAAGAAAAA
GGGCCAACCACTGGGGAAAAGGCCAATGATGAGGCCAATCAGAGTGATACAAGTGTCTCCTTGTCAGAAC
CCAAGAGCAAAAGCAGCCTTCACTTACTGTCCCATGAAACAAAAATTGGATCTTTTCTAAGCAACAGAAC
TTTAGATGGCAAAGACAAAGCTGGCCTTTGTCCAGATGAAGATGATATGGAAGGAGATTCTTTCTTTGAT
GATCCCATTCCTAAGCCAGAGAAAACTTACGGTTTGAGGAAGGAACCTAGGAAGCAAGCAGGAAGTCTGG
CCTCGCTCTCGGATGCACCCCCCTTAAAAAGTGGACTCAGCTCCCTGGCGGGAGCCCCTTCTTTAAAAGA
CTCTGAGAGTAAAAGGGGAAATACAGTTTTGAAAGATCTGAAATTGATCAGTGATAAAATTGGATCACTT
GGATTAGGAACTGGAGAAGATGATGACTATGTTGATGATTTTAATAGTACCAGCCATCGCTCAGAGAAAA
GTGAGATAAGTATTGGTGAAGAGATAGAAGAAGACCTTTCTGTGGAAATAGATGACATCAATACCAGTGA
TAAGACAATCACTCAGCTGGAATGTCTGCTCTCTATTGGTGCCTTGCATTTCAAAAACACTGCAGATATT
TTTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001278690
ORF Size 1056 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001278690.1, NP_001265619.1
RefSeq Size 3451
RefSeq ORF 1056
Locus ID 11116
Protein Families Druggable Genome
Gene Summary This gene encodes a largely hydrophilic centrosomal protein that is required for anchoring microtubules to subcellular structures. A t(6;8)(q27;p11) chromosomal translocation, fusing this gene and the fibroblast growth factor receptor 1 (FGFR1) gene, has been found in cases of myeloproliferative disorder. The resulting chimeric protein contains the N-terminal leucine-rich region of this encoded protein fused to the catalytic domain of FGFR1. Alterations in this gene may also be associated with Crohn's disease, Graves' disease, and vitiligo. Alternatively spliced transcript variants that encode different proteins have been identified. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (3) lacks two consecutive in-frame exons in the internal coding region, and uses an alternate splice site at the 3'-terminal exon, compared to variant 1. The encoded isoform (c) is shorter and has a distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.