BCAT2 (NM_001284325) Human Untagged Clone

CAT#: SC335550

BCAT2 (untagged) - Human branched chain amino-acid transaminase 2, mitochondrial (BCAT2), transcript variant c


  "NM_001284325" in other vectors (1)

Reconstitution Protocol

USD 360.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "BCAT2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BCAT2
Synonyms BCAM; BCATM; BCT2; PP18
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001284325, the custom clone sequence may differ by one or more nucleotides


ATGACACAGAAGCCTCATAAGAAGCCTGGCCCCGGCGAGCCCCTGGTGTTTGGGAAGACATTTACCGACC
ACATGCTGATGGTGGAATGGAATGACAAGGGCTGGGGCCAGCCCCGAATCCAGCCCTTCCAGAACCTCAC
GCTGCACCCAGCCTCCTCCAGCCTCCACTACTCCCTGCAGCTGTTTGAGGGCATGAAGGCGTTCAAAGGC
AAAGACCAGCAGGTGCGCCTCTTCCGCCCCTGGCTCAACATGGACCGGATGCTGCGCTCAGCCATGCGCC
TGTGCCTGCCGAGTTTCGACAAGCTGGAGTTGCTGGAGTGCATCCGCCGGCTCATCGAAGTGGACAAGGA
CTGGGTCCCCGATGCCGCCGGCACCAGCCTCTATGTGCGGCCTGTGCTCATTGGGAACGAGCCCTCGCTG
GGTGTCAGCCAGCCCACGCGCGCGCTCCTGTTCGTCATTCTCTGCCCAGTGGGTGCCTACTTCCCTGGAG
GCTCCGTGACCCCGGTCTCCCTCCTGGCCGACCCAGCCTTCATCCGGGCCTGGGTGGGCGGGGTCGGCAA
CTACAAGTTAGGTGGGAATTATGGGCCCACCGTGTTAGTGCAACAGGAGGCACTCAAGCGGGGCTGTGAA
CAGGTCCTCTGGCTGTATGGGCCCGACCACCAGCTCACCGAGGTGGGAACCATGAACATCTTTGTCTACT
GGACCCACGAAGATGGGGTGCTGGAGCTGGTGACGCCCCCGCTGAATGGTGTTATCCTGCCTGGAGTGGT
CAGACAGAGTCTACTGGACATGGCTCAGACCTGGGGTGAGTTCCGGGTGGTGGAGCGCACGATCACCATG
AAGCAGTTGCTGCGGGCCCTGGAGGAGGGCCGCGTGCGGGAAGTCTTTGGCTCGGGCACCGCTTGCCAGG
TCTGCCCAGTGCACCGAATCCTGTACAAAGACAGGAACCTCCACATTCCCACCATGGAAAATGGGCCTGA
GCTGATCCTCCGCTTCCAGAAGGAGCTGAAGGAGATCCAGTACGGAATCAGAGCCCACGAGTGGATGTTC
CCGGTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001284325
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001284325.1, NP_001271254.1
RefSeq Size 2097 bp
RefSeq ORF 1059 bp
Locus ID 587
Cytogenetics 19q13.33
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Pantothenate and CoA biosynthesis, Valine, leucine and isoleucine biosynthesis, Valine, leucine and isoleucine degradation
Gene Summary 'This gene encodes a branched chain aminotransferase found in mitochondria. The encoded protein forms a dimer that catalyzes the first step in the production of the branched chain amino acids leucine, isoleucine, and valine. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]'
Transcript Variant: This variant (c) uses an alternate 5' exon structure and thus differs in the 5' UTR and 5' coding region, compared to variant a. These differences cause translation initiation at a downstream start codon and result in an isoform (c) with a shorter N-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.