DPP6 (NM_001290253) Human Untagged Clone

CAT#: SC335565

DPP6 (untagged) - Human dipeptidyl-peptidase 6 (DPP6), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DPP6
• Synonyms: DPL1; DPPX; MRD33; VF2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001290253, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTTCGCTGTACCAGAGGTTCACTGGCAAGATCAACACCTCGAGGTCCTTCCCCGCGCCCCCGGAGG
  CGAGTCACCTCCTGGGCGGCCAGGGGCCCGAGGAGGACGGCGGCGCAGGAGCCAAGCCCCTCGGCCCGCG
  GGCGCAGGCGGCGGCGCCCCGGGAGCGCGGCGGCGGCGGCGGCGGCGCGGGTGGCCGGCCCCGGTTCCAG
  TACCAGGCGCGGAGCGATGGTGACGAGGAGGACGAGCTGGTGGGGAGTAACCCTCCGCAGAGGAATTGGA
  AAGGAATAGCAATTGCACTGCTTGTCATTCTGGTCATCTGCTCCTTGATCGTCACCTCGGTCATACTTCT
  GACACCAGCGGAAGATAATAGTCTGTCTCAAAAGAAGAAGGTCACTGTAGAAGATCTCTTCAGTGAAGAC
  TTCAAAATTCATGACCCCGAGGCTAAGTGGATAAGTGATACAGAATTCATCTACAGAGAACAGAAAGGAA
  CAGTGAGACTGTGGAATGTTGAAACAAATACTTCTACTGTCTTAATAGAAGGCAAAAAAATTGAATCATT
  AAGAGCCATCAGATATGAAATATCTCCAGATAGAGAGTATGCACTTTTTTCATACAATGTGGAACCCATG
  AAGAAAGTGAAGTCCAGGAAGTTGACATTGCCTCATTCAAAATCATGTGACTCATTAGCAGTAAGTCAAG
  CCTGTAGCCCAGCTTGTCACCAGGGCTGTTTTCTTCATTACATCACCATGTCTCTTCCTCTTCACTGCCT
  GCGTGACTATGTCTCGGCAGTCAATGGATACAGCACAGCATTGCCAGCTTGCCATGTACAAGGGGGACCT
  GTTTCAGATATTCCATGGAGACCCTGGCTGGAGGATTGCAGGAGAGTCCCAGGAGGCAGGACTGCCAATG
  GCACCAGGCTTCGCAGCCATGCACCTGCAGCCCTCAGGCAGCACTGTCCATTGTCATACGAGTGTGGCAG
  GTGTGAGGCATCGCATCTGCTCACCCCGGGGATAATGCACAGCAGCTACAGGCAGATTTCGGGCCAGAGA
  GCAACCGAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001290253
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001290253.1, NP_001277182.1
• RefSeq Size: 2066 bp
• RefSeq ORF: 1062 bp
• Locus ID: 1804
• Cytogenetics: 7q36.2
• Protein Families: Druggable Genome, Protease, Transmembrane
• Gene Summary: 'This gene encodes a single-pass type II membrane protein that is a member of the peptidase S9B family of serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Variations in this gene may be associated with susceptibility to amyotrophic lateral sclerosis and with idiopathic ventricular fibrillation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]'
  Transcript Variant: This variant (5) lacks several exons, and contains an alternate 3-terminal exon, compared to variant 1. The encoded isoform (5) has a shorter and distinct C-terminus, compared to isoform 1.