ADPRH (NM_001291949) Human Untagged Clone

CAT#: SC335582

ADPRH (untagged) - Human ADP-ribosylarginine hydrolase (ADPRH), transcript variant 2


  "NM_001291949" in other vectors (1)

Reconstitution Protocol

USD 360.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "ADPRH"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ADPRH
Synonyms ARH1; hARH1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001291949, the custom clone sequence may differ by one or more nucleotides


ATGGAGAAGTATGTGGCTGCTATGGTGCTGAGTGCAGCTGGAGATGCCCTGGGGTACTACAATGGGAAGT
GGGAGTTCCTCCAGGATGGGGAGAAGATACACCGGCAGTTGGCCCAGCTGGGCGGCTTGGATGCCCTAGA
CGTGGGAAGGTGGAGAGTTAGTGACGACACAGTGATGCACTTGGCCACAGCAGAAGCTCTTGTGGAAGCT
GGGAAAGCCCCTAAGTTGACTCAACTGTATTACCTCCTTGCTAAGCATTACCAAGACTGCATGGAAGACA
TGGATGGGCGGGCACCAGGTGGTGCCTCGGTGCACAACGCCATGCAGCTGAAGCCGGGCAAGCCCAATGG
CTGGAGGATTCCCTTCAACAGCCATGAGGGCGGCTGTGGGGCTGCCATGCGGGCCATGTGCATCGGTCTC
AGGTTCCCACACCATAGCCAACTGGACACACTGATCCAAGTGAGCATCGAGAGTGGTCGGATGACCCACC
ACCACCCAACAGGCTACCTGGGGGCCCTTGCGTCTGCTCTTTTTACAGCCTATGCTGTGAATAGCAGACC
ACCCTTGCAGTGGGGAAAAGGACTGATGGAGCTGCTACCAGAAGCTAAAAAGTACATTGTCCAATCAGGC
TACTTTGTAGAGGAAAATCTTCAACACTGGTCCTACTTCCAAACCAAATGGGAAAATTACCTAAAACTTA
GAGGGATTTTGGATGGAGAATCAGCCCCTACCTTCCCTGAGTCTTTCGGTGTGAAGGAGAGGGATCAGTT
CTACACCTCCCTGAGCTACTCTGGCTGGGGTGGCAGCAGTGGGCACGATGCCCCCATGATTGCCTACGAT
GCTGTTCTTGCTGCAGGAGACTCCTGGAAGGAGCTTGCCCACCGAGCCTTTTTCCATGGTGGAGACAGTG
ATTCTACAGCTGCCATTGCTGGCTGCTGGTGGGGAGTTATGTATGGTTTTAAAGGAGTGAGTCCCTCCAA
CTATGAGAAACTAGAATACAGAAACCGGCTGGAAGAGACAGCTAGGGCTTTATATTCTCTCGGGTCAAAA
GAAGACACTGTAATTTCCCTTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001291949
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291949.1, NP_001278878.1
RefSeq Size 3618 bp
RefSeq ORF 1074 bp
Locus ID 141
Cytogenetics 3q13.33
Gene Summary 'The enzyme encoded by this gene catalyzes removal of mono-ADP-ribose from arginine residues of proteins in the ADP-ribosylation cycle. Unlike the rat and mouse enzymes that require DTT for maximal activity, the human enzyme is DTT-independent. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, May 2014]'
Transcript Variant: This variant (2) lacks an exon in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.