GANC (NM_001301409) Human Untagged Clone

CAT#: SC335588

GANC (untagged) - Human glucosidase, alpha, neutral C (GANC), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GANC
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001301409, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAAGCAGCAGTGAAAGAGGAAATAAGTCTTGAAGATGAAGCTGTAGATAAAAACATTTTCAGAGACT
  GTAACAAGATCGCATTTTACAGGCGTCAGAAACAGTGGCTTTCCAAGAAGTCCACCTATCAGGCATTATT
  GGATTCAGTCACAACAGATGAAGACAGCACCAGGTTCCAAATCATCAATGAAGCAAGTAAGGTTCCTCTC
  CTGGCTGAAATTTATGGTATAGAAGGAAACATTTTCAGGCTTAAAATTAATGAAGAGACTCCTCTAAAAC
  CCAGATTTGAAGTTCCGGATGTCCTCACAAGCAAGCCAAGCACTGTAAGGCTGATTTCATGCTCTGGGGA
  CACAGGCAGTCTGATATTGGCAGATGGAAAAGGAGACCTGAAGTGCCATATCACAGCAAACCCATTCAAG
  GTAGACTTGGTGTCTGAAGAAGAGGTTGTGATTAGCATAAATTCCCTGGGCCAATTATACTTTGAGCATC
  TACAGATTCTTCACAAACAAAGAGCTGCTAAAGAAAATGAGGAGGAGACATCAGTGGACACCTCTCAGGA
  AAATCAAGAAGATCTGGGCCTGTGGGAAGAGAAATTTGGAAAATTTGTGGATATCAAAGCTAATGGCCCT
  TCTTCTATTGGTTTGGATTTCTCCTTGCATGGATTTGAGCATCTTTATGGGATCCCACAACATGCAGAAT
  CACACCAACTTAAAAATACTGGTGATGGAGATGCTTACCGTCTTTATAACCTGGATGTCTATGGATACCA
  AATATATGATAAAATGGGCATTTATGGTTCAGTACCTTATCTCCTGGCCCACAAACTGGGCAGAACTATA
  GGTATTTTCTGGCTGAATGCCTCGGAAACACTGGTGGAGATCAATACAGAGCCTGCAGTAGAGTACACAC
  TGACCCAGATGGGCCCAGTTGCTGCTAAACAAAAGGTCAGATCTCGCACTCATGTGCACTGGATGTCAGA
  GAGTGGCATCATTGATGTTTTTCTGCTGACAGGACCTACACCTTCTGATGTCTTCAAACAGTACTCACAC
  CTTACAGACATTGGAGAAAAATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301409
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001301409.1, NP_001288338.1
• RefSeq Size: 2533 bp
• RefSeq ORF: 1074 bp
• Locus ID: 2595
• Cytogenetics: 15q15.1
• Protein Families: Druggable Genome
• Protein Pathways: Galactose metabolism, Metabolic pathways, Starch and sucrose metabolism
• Gene Summary: 'Glycosyl hydrolase enzymes hydrolyse the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. This gene encodes a member of glycosyl hydrolases family 31. This enzyme hydrolyses terminal, non-reducing 1,4-linked alpha-D-glucose residues and releases alpha-D-glucose. This is a key enzyme in glycogen metabolism and its gene localizes to a chromosomal region (15q15) that is associated with susceptibility to diabetes. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2014]'
  Transcript Variant: This variant (2) lacks several exons in the 3' coding region, and contains an alternate 3' terminal exon, compared to variant 1. It encodes isoform 2 which is shorter, and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.