PAX5 (NM_001280547) Human Untagged Clone

CAT#: SC335589

PAX5 (untagged) - Human paired box 5 (PAX5), transcript variant 2


  "NM_001280547" in other vectors (1)

Reconstitution Protocol

USD 360.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "PAX5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PAX5
Synonyms ALL3; BSAP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001280547, the custom clone sequence may differ by one or more nucleotides


ATGGATTTAGAGAAAAATTATCCGACTCCTCGGACCAGCAGGACAGGACATGGAGGAGTGAATCAGCTTG
GGGGGGTTTTTGTGAATGGACGGCCACTCCCGGATGTAGTCCGCCAGAGGATAGTGGAACTTGCTCATCA
AGGTGTCAGGCCCTGCGACATCTCCAGGCAGCTTCGGGTCAGCCATGGTTGTGTCAGCAAAATTCTTGGC
AGGTATTATGAGACAGGAAGCATCAAGCCTGGGGTAATTGGAGGATCCAAACCAAAGGTCGCCACACCCA
AAGTGGTGGAAAAAATCGCTGAATATAAACGCCAAAATCCCACCATGTTTGCCTGGGAGATCAGGGACCG
GCTGCTGGCAGAGCGGGTGTGTGACAATGACACCGTGCCTAGCGTCAGTTCCATCAACAGGATCATCCGG
ACAAAAGTACAGCAGCCACCCAACCAACCAGTCCCAGCTTCCAGTCACAGCATAGTGTCCACTGGCTCCG
TGACGCAGGTGTCCTCGGTGAGCACGGATTCGGCCGGCTCGTCGTACTCCATCAGCGGCATCCTGGGCAT
CACGTCCCCCAGCGCCGACACCAACAAGCGCAAGAGAGACGAAGGTATTCAGGAGTCTCCGGTGCCGAAC
GGCCACTCGCTTCCGGGCAGAGACTTCCTCCGGAAGCAGATGCGGGGAGACTTGTTCACACAGCAGCAGC
TGGAGGTGCTGGACCGCGTGTTTGAGAGGCAGCACTACTCAGACATCTTCACCACCACAGAGCCCATCAA
GCCCGAGCAGACCACAGAGTATTCAGCCATGGCCTCGCTGGCTGGTGGGCTGGACGACATGAAGGCCAAT
CTGGCCAGCCCCACCCCTGCTGACATCGGGAGCAGTGTGCCAGGCCCGCAGTCCTACCCCATTGTGACAG
GGAGTGAGTTTTCCGGGAGTCCCTACAGCCACCCTCAGTATTCCTCGTACAACGACTCCTGGAGGTTCCC
CAACCCGGGGCTGCTTGGCTCCCCCTACTATTATAGCGCTGCCGCCCGAGGAGCCGCCCCACCTGCAGCC
GCCACTGCCTATGACCGTCACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001280547
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001280547.1, NP_001267476.1
RefSeq Size 8807 bp
RefSeq ORF 1074 bp
Locus ID 5079
Cytogenetics 9p13.2
Protein Families Transcription Factors
Gene Summary 'This gene encodes a member of the paired box (PAX) family of transcription factors. The central feature of this gene family is a novel, highly conserved DNA-binding motif, known as the paired box. Paired box transcription factors are important regulators in early development, and alterations in the expression of their genes are thought to contribute to neoplastic transformation. This gene encodes the B-cell lineage specific activator protein that is expressed at early, but not late stages of B-cell differentiation. Its expression has also been detected in developing CNS and testis and so the encoded protein may also play a role in neural development and spermatogenesis. This gene is located at 9p13, which is involved in t(9;14)(p13;q32) translocations recurring in small lymphocytic lymphomas of the plasmacytoid subtype, and in derived large-cell lymphomas. This translocation brings the potent E-mu enhancer of the IgH gene into close proximity of the PAX5 promoter, suggesting that the deregulation of transcription of this gene contributes to the pathogenesis of these lymphomas. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]'
Transcript Variant: This variant (2) lacks an in-frame exon in the 3' coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.