ST13 (NM_001278589) Human Untagged Clone

CAT#: SC335605

ST13 (untagged) - Human suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) (ST13), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ST13
• Synonyms: AAG2; FAM10A1; FAM10A4; HIP; HOP; HSPABP; HSPABP1; P48; PRO0786; SNC6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001278589, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACCCCCGCAAAGTGAACGAGCTTCGGGCCTTTGTGAAAATGTGTAAGCAGGATCCGAGCGTTCTGC
  ACACCGAGGAAATGCGCTTCCTGAGGGAGTGGGTGGAGAGCATGGGTGGTAAAGTACCACCTGCTACTCA
  GAAAGCTAAATCAGAAGAAAATACCAAGGAAGACTTAAAGGCAGACGAACCATCAAGTGAGGAAAGTGAT
  CTAGAAATTGATAAAGAAGGTGTGATTGAACCAGACACTGATGCTCCTCAAGAAATGGGAGATGAAAATG
  CGGAGATAACGGAGGAGATGATGGATCAGGCAAATGATAAAAAAGTGGCTGCTATTGAAGCCCTAAATGA
  TGGTGAACTCCAGAAAGCCATTGACTTATTCACAGATGCCATCAAGCTGAATCCTCGCTTGGCCATTTTG
  TATGCCAAGAGGGCCAGTGTCTTCGTCAAATTACAGAAGCCAAATGCTGCCATCCGAGACTGTGACAGAG
  CCATTGAAATAAATCCTGATTCAGCTCAGCCTTACAAGTGGCGGGGGAAAGCACACAGACTTCTAGGCCA
  CTGGGAAGAAGCAGCCCATGATCTTGCCCTTGCCTGTAAATTGGATTATGATGAAGATGCTAGTGCAATG
  CTGAAAGAAGTTCAACCTAGGGCACAGAAAATTGCAGAACATCGGAGAAAGTATGAGCGAAAACGTGAAG
  AGCGAGAGATCAAAGAAAGAATAGAACGAGTTAAGAAGGCTCGAGAAGAGCATGAGAGAGCCCAGAGGGA
  GGAAGAAGCCAGACGACAGTCAGGAGCTCAGTATGGCTCTTTTCCAGGTGGCTTTCCTGGGGGAATGCCT
  GGTAATTTTCCCGGAGGAATGCCTGGAATGGGAGGGGGCATGCCTGGAATGGCTGGAATGCCTGGACTCA
  ATGAAATTCTTAGTGATCCAGAGGTTCTTGCAGCCATGCAGGATCCAGAAGTTATGGTGGCTTTCCAGGA
  TGTGGCTCAGAACCCAGCAAATATGTCAAAATACCAGAGCAACCCAAAGGTTATGAATCTCATCAGTAAA
  TTGTCAGCCAAATTTGGAGGTCAAGCGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278589
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278589.1, NP_001265518.1
• RefSeq Size: 3567 bp
• RefSeq ORF: 1080 bp
• Locus ID: 6767
• Cytogenetics: 22q13.2
• Protein Families: Druggable Genome
• Gene Summary: 'The protein encoded by this gene is an adaptor protein that mediates the association of the heat shock proteins HSP70 and HSP90. This protein has been shown to be involved in the assembly process of glucocorticoid receptor, which requires the assistance of multiple molecular chaperones. The expression of this gene is reported to be downregulated in colorectal carcinoma tissue suggesting that it is a candidate tumor suppressor gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]'
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.