PTP1B (PTPN1) (NM_001278618) Human Untagged Clone

CAT#: SC335618

PTPN1 (untagged) - Human protein tyrosine phosphatase, non-receptor type 1 (PTPN1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PTPN1
• Synonyms: PTP1B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001278618, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAAGAAGCCCAAAGGAGTTACATTCTTACCCAGGGCCCTTTGCCTAACACATGCGGTCACTTTTGGG
  AGATGGTGTGGGAGCAGAAAAGCAGGGGTGTCGTCATGCTCAACAGAGTGATGGAGAAAGGTTCGTTAAA
  ATGCGCACAATACTGGCCACAAAAAGAAGAAAAAGAGATGATCTTTGAAGACACAAATTTGAAATTAACA
  TTGATCTCTGAAGATATCAAGTCATATTATACAGTGCGACAGCTAGAATTGGAAAACCTTACAACCCAAG
  AAACTCGAGAGATCTTACATTTCCACTATACCACATGGCCTGACTTTGGAGTCCCTGAATCACCAGCCTC
  ATTCTTGAACTTTCTTTTCAAAGTCCGAGAGTCAGGGTCACTCAGCCCGGAGCACGGGCCCGTTGTGGTG
  CACTGCAGTGCAGGCATCGGCAGGTCTGGAACCTTCTGTCTGGCTGATACCTGCCTCTTGCTGATGGACA
  AGAGGAAAGACCCTTCTTCCGTTGATATCAAGAAAGTGCTGTTAGAAATGAGGAAGTTTCGGATGGGGCT
  GATCCAGACAGCCGACCAGCTGCGCTTCTCCTACCTGGCTGTGATCGAAGGTGCCAAATTCATCATGGGG
  GACTCTTCCGTGCAGGATCAGTGGAAGGAGCTTTCCCACGAGGACCTGGAGCCCCCACCCGAGCATATCC
  CCCCACCTCCCCGGCCACCCAAACGAATCCTGGAGCCACACAATGGGAAATGCAGGGAGTTCTTCCCAAA
  TCACCAGTGGGTGAAGGAAGAGACCCAGGAGGATAAAGACTGCCCCATCAAGGAAGAAAAAGGAAGCCCC
  TTAAATGCCGCACCCTACGGCATCGAAAGCATGAGTCAAGACACTGAAGTTAGAAGTCGGGTCGTGGGGG
  GAAGTCTTCGAGGTGCCCAGGCTGCCTCCCCAGCCAAAGGGGAGCCGTCACTGCCCGAGAAGGACGAGGA
  CCATGCACTGAGTTACTGGAAGCCCTTCCTGGTCAACATGTGCGTGGCTACGGTCCTCACGGCCGGCGCT
  TACCTCTGCTACAGGTTCCTGTTCAACAGCAACACATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278618
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278618.1, NP_001265547.1
• RefSeq Size: 3482 bp
• RefSeq ORF: 1089 bp
• Locus ID: 5770
• Cytogenetics: 20q13.13
• Protein Families: Druggable Genome, Phosphatase, Transmembrane
• Protein Pathways: Adherens junction, Insulin signaling pathway
• Gene Summary: 'The protein encoded by this gene is the founding member of the protein tyrosine phosphatase (PTP) family, which was isolated and identified based on its enzymatic activity and amino acid sequence. PTPs catalyze the hydrolysis of the phosphate monoesters specifically on tyrosine residues. Members of the PTP family share a highly conserved catalytic motif, which is essential for the catalytic activity. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP has been shown to act as a negative regulator of insulin signaling by dephosphorylating the phosphotryosine residues of insulin receptor kinase. This PTP was also reported to dephosphorylate epidermal growth factor receptor kinase, as well as JAK2 and TYK2 kinases, which implicated the role of this PTP in cell growth control, and cell response to interferon stimulation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]'
  Transcript Variant: This variant (2) lacks an alternate exon in the 5' coding region and uses a downstream start codon compared to variant 1. It encodes isoform 2, which has a shorter N-terminus compared to isoform 1.