DFFB (NM_001282669) Human Untagged Clone

CAT#: SC335625

DFFB (untagged) - Human DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase) (DFFB), transcript variant 1


  "NM_001282669" in other vectors (1)

Reconstitution Protocol

USD 370.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "DFFB"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DFFB
Synonyms CAD; CPAN; DFF-40; DFF2; DFF40
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282669, the custom clone sequence may differ by one or more nucleotides


ATGCTCCAGAAGCCCAAGAGCGTGAAGCTGCGGGCCCTGCGCAGCCCGAGGAAGTTCGGCGTGGCTGGCC
GGAGCTGCCAGGAGGTGCTGCGCAAGGGCTGTCTCCGCTTCCAGCTCCCTGAGCGCGGTTCCCGGCTGTG
CCTGTACGAGGATGGCACGGAGCTGACGGAAGATTACTTCCCCAGTGTTCCCGACAACGCCGAGCTGGTG
CTGCTCACCTTGGGCCAGGCCTGGCAGGGCTGTGAGTGGCAAGGACTTTGGAGGATGTGTCTTCTGCTGG
ACCGGCACCTTTTGTTTGTCCCATTGGTGGCAGATGTGAGCGACATCAGGCGCTTCCTCAGTGCATTTCA
CGAGCCACAGGTGGGGCTCATCCAGGCCGCCCAGCAGCTGCTGTGTGATGAGCAGGCCCCACAGAGGCAG
AGGCTGCTGGCTGACCTCCTGCACAACGTCAGCCAGAACATCGCGGCCGAGACCCGGGCTGAGGACCCGC
CGTGGTTTGAAGGCTTGGAGTCCCGATTTCAGAGCAAGTCTGGCTATCTGAGATACAGCTGTGAGAGCCG
GATCCGGAGTTACCTGAGGGAGGTGAGCTCCTACCCCTCCACGGTGGGTGCGGAGGCTCAGGAGGAATTC
CTGCGGGTCCTCGGCTCCATGTGCCAGAGGCTCCGGTCCATGCAGTACAATGGCAGCTACTTCGACAGAG
GAGCCAAGGGCGGCAGCCGCCTCTGCACACCGGAAGGCTGGTTCTCCTGCCAGGGTCCCTTTGACATGGA
CAGCTGCTTATCAAGACACTCCATCAACCCCTACAGTAACAGGGAGAGCAGGATCCTCTTCAGCACCTGG
AACCTGGATCACATAATAGAAAAGAAACGCACCATCATTCCTACACTGGTGGAAGCAATTAAGGAACAAG
ATGGAAGAGAAGTGGACTGGGAGTATTTTTATGGCCTGCTTTTTACCTCAGAGAACCTAAAACTAGTGCA
CATTGTCTGCCATAAGAAAACCACCCACAAGCTCAACTGTGACCCAAGCAGAATCTACAAACCCCAGACA
AGGTTGAAGCGGAAGCAGCCTGTGCGGAAACGCCAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001282669
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282669.1, NP_001269598.1
RefSeq Size 3120 bp
RefSeq ORF 1089 bp
Locus ID 1677
Cytogenetics 1p36.32
Protein Families Druggable Genome
Protein Pathways Apoptosis
Gene Summary 'Apoptosis is a cell death process that removes toxic and/or useless cells during mammalian development. The apoptotic process is accompanied by shrinkage and fragmentation of the cells and nuclei and degradation of the chromosomal DNA into nucleosomal units. DNA fragmentation factor (DFF) is a heterodimeric protein of 40-kD (DFFB) and 45-kD (DFFA) subunits. DFFA is the substrate for caspase-3 and triggers DNA fragmentation during apoptosis. DFF becomes activated when DFFA is cleaved by caspase-3. The cleaved fragments of DFFA dissociate from DFFB, the active component of DFF. DFFB has been found to trigger both DNA fragmentation and chromatin condensation during apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of some of these variants has not been determined. [provided by RefSeq, Sep 2013]'
Transcript Variant: This variant (1) encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.