UGT (UGT2B4) (NM_001297615) Human Untagged Clone

CAT#: SC335668

UGT2B4 (untagged) - Human UDP glucuronosyltransferase 2 family, polypeptide B4 (UGT2B4), transcript variant 2


  "NM_001297615" in other vectors (1)

Reconstitution Protocol

USD 370.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "UGT2B4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UGT2B4
Synonyms HLUG25; UDPGT2B4; UDPGTh-1; UDPGTH1; UGT2B11
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001297615, the custom clone sequence may differ by one or more nucleotides


ATGTCTATGAAATGGACTTCAGCTCTTCTGCTGATACAGCTGAGCTGTTACTTTAGCTCTGGGAGTTGTG
GAAAGGTGCTGGTGTGGCCCACAGAATTCAGCCACTGGATGAATATAAAGACAATCCTGGATGAACTTGT
CCAGAGAGGTCATGAGGTGACTGTATTGGCATCTTCAGCTTCCATTTCTTTCGATCCCAACAGCCCATCT
ACTCTTAAATTTGAAGTTTATCCTGTATCTTTAACTAAAACTGAGTTTGAGGATATTATCAAGCAGCTGG
TTAAGAGATGGGCAGAACTTCCAAAAGACACATTTTGGTCATATTTTTCACAAGTACAAGAAATCATGTG
GACATTTAATGACATACTTAGAAAGTTCTGTAAGGATATAGTTTCAAATAAGAAACTTATGAAGAAACTA
CAGGAGTCAAGATTTGATGTTGTTCTTGCAGATGCTGTTTTCCCCTTTGGTGAGCTGCTGGCCGAGTTAC
TTAAAATACCCTTTGTCTACAGCCTCCGCTTCTCTCCTGGCTACGCAATTGAAAAGCATAGTGGAGGACT
TCTGTTCCCTCCTTCCTATGTGCCTGTTGTTATGTCAGAACTAAGTGACCAAATGACTTTCATAGAGAGG
GTAAAAAATATGATCTATGTGCTTTATTTTGAATTTTGGTTCCAAATATTTGACATGAAGAAGTGGGATC
AGTTCTACAGTGAAGTTCTAGGAAGACCCACTACGTTATCTGAGACAATGGCAAAAGCTGACATATGGCT
TATTCGAAACTACTGGGATTTTCAATTTCCTCACCCACTCTTACCAAATGTTGAGTTCGTTGGAGGACTC
CACTGCAAACCTGCCAAACCCCTACCGAAGGAAATGGAAGAGTTTGTCCAGAGCTCTGGAGAAAATGGTG
TTGTGGTGTTTTCTCTGGGGTCGATGGTCAGTAACACGTCAGAAGAAAGGGCCAATGTAATTGCATCAGC
CCTTGCCAAGATCCCACAAAAGGTTCTGTGGAGATTTGATGGGAATAAACCAGATACTTTAGGACTCAAT
ACTCGGCTGTACAAGTGGATACCCCAGAATGATCTTCTTGATATAAAGAGAATGCTATGA


Restriction Sites SgfI-MluI     
ACCN NM_001297615
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001297615.1, NP_001284544.1
RefSeq Size 1899 bp
RefSeq ORF 1110 bp
Locus ID 7363
Cytogenetics 4q13.3
Protein Families Druggable Genome, Transmembrane
Protein Pathways Androgen and estrogen metabolism, Ascorbate and aldarate metabolism, Drug metabolism - cytochrome P450, Drug metabolism - other enzymes, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Pentose and glucuronate interconversions, Porphyrin and chlorophyll metabolism, Retinol metabolism, Starch and sucrose metabolism
Gene Summary ''
Transcript Variant: This variant (2) lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.