CCR7 (NM_001301718) Human Untagged Clone
CAT#: SC335701
CCR7 (untagged) - Human chemokine (C-C motif) receptor 7 (CCR7), transcript variant 5
"NM_001301718" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CCR7 |
Synonyms | BLR2; CC-CKR-7; CCR-7; CD197; CDw197; CMKBR7; EBI1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001301718, the custom clone sequence may differ by one or more nucleotides
ATGAAAAGCGTGCTGGTGGTGGCTCTCCTTGTCATTTTCCAGGTATGCCTGTGTCAAGATGAGGTCACGG ACGATTACATCGGAGACAACACCACAGTGGACTACACTTTGTTCGAGTCTTTGTGCTCCAAGAAGGACGT GCGGAACTTTAAAGCCTGGTTCCTCCCTATCATGTACTCCATCATTTGTTTCGTGGGCCTACTGGGCAAT GGGCTGGTCGTGTTGACCTATATCTATTTCAAGAGGCTCAAGACCATGACCGATACCTACCTGCTCAACC TGGCGGTGGCAGACATCCTCTTCCTCCTGACCCTTCCCTTCTGGGCCTACAGCGCGGCCAAGTCCTGGGT CTTCGGTGTCCACTTTTGCAAGCTCATCTTTGCCATCTACAAGATGAGCTTCTTCAGTGGCATGCTCCTA CTTCTTTGCATCAGCATTGACCGCTACGTGGCCATCGTCCAGGCTGTCTCAGCTCACCGCCACCGTGCCC GCGTCCTTCTCATCAGCAAGCTGTCCTGTGTGGGCATCTGGATACTAGCCACAGTGCTCTCCATCCCAGA GCTCCTGTACAGTGACCTCCAGAGGAGCAGCAGTGAGCAAGCGATGCGATGCTCTCTCATCACAGAGCAT GTGGAGGCCTTTATCACCATCCAGGTGGCCCAGATGGTGATCGGCTTTCTGGTCCCCCTGCTGGCCATGA GCTTCTGTTACCTTGTCATCATCCGCACCCTGCTCCAGGCACGCAACTTTGAGCGCAACAAGGCCATCAA GGTGATCATCGCTGTGGTCGTGGTCTTCATAGTCTTCCAGCTGCCCTACAATGGGGTGGTCCTGGCCCAG ACGGTGGCCAACTTCAACATCACCAGTAGCACCTGTGAGCTCAGTAAGCAACTCAACATCGCCTACGACG TCACCTACAGCCTGGCCTGCGTCCGCTGCTGCGTCAACCCTTTCTTGTACGCCTTCATCGGCGTCAAGTT CCGCAACGATCTCTTCAAGCTCTTCAAGGACCTGGGCTGCCTCAGCCAGGAGCAGCTCCGGCAGTGGTCT TCCTGTCGGCACATCCGGCGCTCCTCCATGAGTGTGGAGGCCGAGACCACCACCACCTTCTCCCCATAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301718 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001301718.1, NP_001288647.1 |
RefSeq Size | 2303 bp |
RefSeq ORF | 1119 bp |
Locus ID | 1236 |
Cytogenetics | 17q21.2 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction |
Gene Summary | 'The protein encoded by this gene is a member of the G protein-coupled receptor family. This receptor was identified as a gene induced by the Epstein-Barr virus (EBV), and is thought to be a mediator of EBV effects on B lymphocytes. This receptor is expressed in various lymphoid tissues and activates B and T lymphocytes. It has been shown to control the migration of memory T cells to inflamed tissues, as well as stimulate dendritic cell maturation. The chemokine (C-C motif) ligand 19 (CCL19/ECL) has been reported to be a specific ligand of this receptor. Signals mediated by this receptor regulate T cell homeostasis in lymph nodes, and may also function in the activation and polarization of T cells, and in chronic inflammation pathogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]' Transcript Variant: This variant (5) contains an alternate 5' terminal exon, and it thus differs in its 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a. Variants 3, 4 and 5 all encode isoform c. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237807 | CCR7 (myc-DDK-tagged) - Human chemokine (C-C motif) receptor 7 (CCR7), transcript variant 5 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review