Mannose Phosphate Isomerase (MPI) (NM_001289156) Human Untagged Clone

CAT#: SC335703

MPI (untagged) - Human mannose phosphate isomerase (MPI), transcript variant 3


  "NM_001289156" in other vectors (1)

Reconstitution Protocol

USD 380.00

2 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MPI
Synonyms CDG1B; PMI; PMI1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001289156, the custom clone sequence may differ by one or more nucleotides


ATGGGGACTCACCCCCGAGGGGATGCCAAGATCCTTGACAACCGCATCTCACAGAAGACCCTAAGCCAGT
GGATTGCTGAGAACCAGGACAGCTTGGGCTCAAAGGTCAAGGACACCTTTAATGGCAACCTGCCCTTCCT
CTTCAAAGTGCTCTCAGTTGAAACACCCCTGTCCATCCAGGCACACCCTAACAAGGAGCTGGCAGAGAAG
CTGCACCTCCAGGCTCCGCAGCACTACCCCGATGCCAACCACAAGCCAGAGATGGCCATTGCCCTCACCC
CCTTCCAGGGCTTGTGTGGCTTCCGGCCAGTTGAGGAGATTGTAACCTTTCTAAAGAAGGTGCCTGAGTT
TCAGTTCCTGATTGGAGATGAGGCAGCAACACACCTGAAGCAGACCATGAGCCATGACTCCCAGGCTGTG
GCCTCCTCTCTGCAGAGCTGTTTCTCCCACCTGATGAAGAGTGAGAAGAAGGTGGTGGTGGAACAGCTCA
ACCTGTTGGTGAAGCGGATCTCCCAGCAAGCGGCTGCCGGAAACAACATGGAGGACATCTTTGGGGAGCT
TTTGCTACAGCTGCACCAGCAGTACCCAGGTGATATCGGCTGCTTTGCCATCTACTTCCTGAACCTGCTT
ACCCTGAAGCCTGGGGAGGCCATGTTTCTGGAGGCCAACGTACCCCATGCCTACCTGAAAGGAGACTGCG
TGGAGTGCATGGCGTGTTCAGACAACACAGTTCGTGCTGGCCTGACACCCAAGTTCATTGATGTGCCAAC
CCTGTGTGAAATGCTCAGCTATACCCCTAGCTCCAGCAAGGACAGGCTCTTTCTCCCAACACGGAGTCAG
GAAGACCCCTACCTCTCAATCTATGACCCCCCTGTACCAGACTTCACCATTATGAAGACGGAGGTCCCTG
GCTCTGTCACTGAATACAAGGTCTTGGCACTGGACTCTGCCAGCATCCTCCTGATGGTACAGGGGACAGT
AATAGCCAGCACACCCACAACCCAGACACCAATCCCTCTGCAACGTGGTGGCGTGCTCTTCATTGGGGCC
AATGAGAGTGTCTCACTGAAGCTTACTGAGCCGAAGGACCTGCTGATATTCCGTGCCTGCTGTCTGCTGT
AA


Restriction Sites SgfI-MluI     
ACCN NM_001289156
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289156.1, NP_001276085.1
RefSeq Size 2949 bp
RefSeq ORF 1122 bp
Locus ID 4351
Cytogenetics 15q24.1
Protein Families ES Cell Differentiation/IPS
Protein Pathways Amino sugar and nucleotide sugar metabolism, Fructose and mannose metabolism, Metabolic pathways
Gene Summary 'Phosphomannose isomerase catalyzes the interconversion of fructose-6-phosphate and mannose-6-phosphate and plays a critical role in maintaining the supply of D-mannose derivatives, which are required for most glycosylation reactions. Mutations in the MPI gene were found in patients with carbohydrate-deficient glycoprotein syndrome, type Ib. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]'
Transcript Variant: This variant (3) lacks part of the 5' coding region, and uses a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.