Mannose Phosphate Isomerase (MPI) (NM_001289156) Human Untagged Clone
CAT#: SC335703
MPI (untagged) - Human mannose phosphate isomerase (MPI), transcript variant 3
"NM_001289156" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MPI |
Synonyms | CDG1B; PMI; PMI1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001289156, the custom clone sequence may differ by one or more nucleotides
ATGGGGACTCACCCCCGAGGGGATGCCAAGATCCTTGACAACCGCATCTCACAGAAGACCCTAAGCCAGT GGATTGCTGAGAACCAGGACAGCTTGGGCTCAAAGGTCAAGGACACCTTTAATGGCAACCTGCCCTTCCT CTTCAAAGTGCTCTCAGTTGAAACACCCCTGTCCATCCAGGCACACCCTAACAAGGAGCTGGCAGAGAAG CTGCACCTCCAGGCTCCGCAGCACTACCCCGATGCCAACCACAAGCCAGAGATGGCCATTGCCCTCACCC CCTTCCAGGGCTTGTGTGGCTTCCGGCCAGTTGAGGAGATTGTAACCTTTCTAAAGAAGGTGCCTGAGTT TCAGTTCCTGATTGGAGATGAGGCAGCAACACACCTGAAGCAGACCATGAGCCATGACTCCCAGGCTGTG GCCTCCTCTCTGCAGAGCTGTTTCTCCCACCTGATGAAGAGTGAGAAGAAGGTGGTGGTGGAACAGCTCA ACCTGTTGGTGAAGCGGATCTCCCAGCAAGCGGCTGCCGGAAACAACATGGAGGACATCTTTGGGGAGCT TTTGCTACAGCTGCACCAGCAGTACCCAGGTGATATCGGCTGCTTTGCCATCTACTTCCTGAACCTGCTT ACCCTGAAGCCTGGGGAGGCCATGTTTCTGGAGGCCAACGTACCCCATGCCTACCTGAAAGGAGACTGCG TGGAGTGCATGGCGTGTTCAGACAACACAGTTCGTGCTGGCCTGACACCCAAGTTCATTGATGTGCCAAC CCTGTGTGAAATGCTCAGCTATACCCCTAGCTCCAGCAAGGACAGGCTCTTTCTCCCAACACGGAGTCAG GAAGACCCCTACCTCTCAATCTATGACCCCCCTGTACCAGACTTCACCATTATGAAGACGGAGGTCCCTG GCTCTGTCACTGAATACAAGGTCTTGGCACTGGACTCTGCCAGCATCCTCCTGATGGTACAGGGGACAGT AATAGCCAGCACACCCACAACCCAGACACCAATCCCTCTGCAACGTGGTGGCGTGCTCTTCATTGGGGCC AATGAGAGTGTCTCACTGAAGCTTACTGAGCCGAAGGACCTGCTGATATTCCGTGCCTGCTGTCTGCTGT AA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289156 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001289156.1, NP_001276085.1 |
RefSeq Size | 2949 bp |
RefSeq ORF | 1122 bp |
Locus ID | 4351 |
Cytogenetics | 15q24.1 |
Protein Families | ES Cell Differentiation/IPS |
Protein Pathways | Amino sugar and nucleotide sugar metabolism, Fructose and mannose metabolism, Metabolic pathways |
Gene Summary | 'Phosphomannose isomerase catalyzes the interconversion of fructose-6-phosphate and mannose-6-phosphate and plays a critical role in maintaining the supply of D-mannose derivatives, which are required for most glycosylation reactions. Mutations in the MPI gene were found in patients with carbohydrate-deficient glycoprotein syndrome, type Ib. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]' Transcript Variant: This variant (3) lacks part of the 5' coding region, and uses a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237809 | MPI (myc-DDK-tagged) - Human mannose phosphate isomerase (MPI), transcript variant 3 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review