IDH3B (NM_001258384) Human Untagged Clone

CAT#: SC335729

IDH3B (untagged) - Human isocitrate dehydrogenase 3 (NAD+) beta (IDH3B), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IDH3B
• Synonyms: RP46
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001258384, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGCATTGAGCGGAGTCCGCTGGCTGACCCGAGCGCTGGTCTCCGCCGGGAACCCTGGGGCATGGA
  GAGGTCTGAGTACCTCGGCCGCGGCGCACGCTGCATCGCGGAGCCAGGCCGAGGACGTGAGGGTGGAGGG
  CTCCTTTCCCGTGACCATGCTTCCGGGAGACGGTGTGGGGCCTGAGCTGATGCACGCCGTCAAGGAGGTG
  TTCAAGGCTGCCGCTGTCCCAGTGGAGTTCCAGGAGCACCACCTGAGTGAGGTGCAGAATATGGCATCTG
  AGGAGAAGCTGGAGCAGGTGCTGAGTTCCATGAAGGAGAACAAAGTGGCCATCATTGGAAAGATTCATAC
  CCCGATGGAGTATAAGGGGGAGCTAGCCTCCTATGATATGCGGCTGAGGCGTAAGTTGGACTTATTTGCC
  AACGTAGTCCATGTGAAGTCACTTCCTGGGTATATGACTCGGCACAACAATCTAGACCTGGTGATCATTC
  GAGAGCAGACAGAAGGGGAGTACAGCTCTCTGGAACATGAGAGTGCAAGGGGTGTGATTGAGTGTTTGAA
  GATTGTCACACGAGCCAAGTCTCAGCGGATTGCAAAGTTCGCCTTTGACTATGCCACCAAGAAGGGGCGG
  GGCAAGGTCACTGCTGTCCACAAGGCCAACATCATGAAACTTGGGGATGGGTTGTTCCTGCAGTGCTGTG
  AGGAAGTTGCTGAACTGTACCCCAAAATCAAATTTGAGACAATGATCATAGACAACTGCTGCATGCAGCT
  GGTGCAGAATCCTTACCAGTTTGATGTGCTTGTGATGCCCAATCTCTATGGGAACATTATTGACAATCTG
  GCTGCTGGCCTGGTTGGGGGAGCTGGTGTGGTCCCTGGTGAGAGCTATAGTGCAGAATACGCAGTCTTTG
  AGACGGGTGCCCGGCACCCATTTGCCCAGGCAGTGGGCAGGAATATAGCCAATCCCACGGCCATGCTGCT
  GTCGGCTTCCAACATGCTGCGGCATCTTAATCTTGAGTATCACTCCAGCATGATCGCAGATGCGGTGAAG
  AAGGTGATCAAAGTTGGCAAGATCCCATCTGCTGTTCCCTCTTTCCTGCTCCATCCACTGCCCTTTTCAT
  GGGCCATCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001258384
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001258384.2, NP_001245313.1
• RefSeq Size: 1404 bp
• RefSeq ORF: 1131 bp
• Locus ID: 3420
• Cytogenetics: 20p13
• Protein Pathways: Citrate cycle (TCA cycle), Metabolic pathways
• Gene Summary: 'Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the beta subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2016]'
  Transcript Variant: This variant (4) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (d) has a shorter and distinct C-terminus compared to isoform a.