Synaptotagmin V (SYT5) (NM_001297774) Human Untagged Clone

CAT#: SC335762

SYT5 (untagged) - Human synaptotagmin V (SYT5), transcript variant 2


  "NM_001297774" in other vectors (1)

Reconstitution Protocol

USD 380.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "SYT5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SYT5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001297774, the custom clone sequence may differ by one or more nucleotides


ATGACTCGCGGTGGCTGTCCGGTTTCTGCGCGGCTGTTCGCGCAAAGGCCTCATGGGAGTTGGAGTTCTT
TGTTGTGCGTGGGGCTCAAAGGACGTCTGGGGTGGGAATGGGGGACTAGGGTGCTTGAGTGTCTCTGCAG
AAAAGACTCCAGGACCCCGCCACCATGTTCCCGGAGCCCCCAACCCCGGGGCCTCCATCGCCCGACACGC
CTCCCGACTCCAGTCGCATCAGCCACGGCCCAGGTGCAGCCAGAAGTAGAGGAGCTGGAGCCAGCACCAT
CCGGGCCAGGGCAGCAGGTGGCAGACAAGCATGAGCTAGGACGACTGCAGTACTCCCTGGATTATGACTT
CCAGAGTGGCCAGCTGCTGGTGGGCATTCTGCAAGCAATGGGATTGGCAGCCTTGGATCTTGGTGGCTCC
TCGGACCCCTATGTGCGGGTCTACCTGCTGCCGGACAAACGGAGGCGGTACGAGACCAAGGTGCATCGGC
AGACGCTGAACCCTCACTTTGGGGAGACCTTCGCCTTCAAGGTCCCCTACGTGGAGCTGGGGGGCAGGGT
GCTGGTCATGGCGGTGTACGACTTCGACCGCTTCTCTCGCAATGACGCCATCGGGGAGGTGCGGGTCCCT
ATGAGCTCCGTGGACCTGGGGCGGCCAGTGCAGGCCTGGCGGGAGCTGCAGGCGGCTCCGCGGGAGGAGG
AGAAGCTTGGGGACATCTGCTTCTCCCTCCGCTATGTCCCCACGGCCGGGAAGCTCACCGTCATCGTCCT
GGAGGCTAAAAACCTGAAGAAGATGGACGTAGGAGGACTGTCAGATCCATACGTCAAGGTCCACCTGCTG
CAGGGCGGCAAAAAGGTGCGGAAGAAGAAAACCACCATCAAGAAGAACACTCTGAACCCCTATTACAACG
AAGCTTTCAGCTTCGAGGTGCCCTGTGACCAAGTCCAGAAGGTGCAGGTGGAGCTGACCGTGCTGGACTA
CGACAAGCTGGGCAAGAACGAGGCCATCGGGAGGGTGGCCGTGGGGGCGGCCGCCGGCGGGGCTGGCCTG
CGGCACTGGGCGGACATGCTGGCCAACCCGCGGCGGCCCATTGCCCAGTGGCACTCGCTGCGGCCCCCGG
ACCGAGTGAGGCTGCTGCCTGCGCCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001297774
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001297774.1, NP_001284703.1
RefSeq Size 1797 bp
RefSeq ORF 1149 bp
Locus ID 6861
Cytogenetics 11p
Protein Families Secreted Protein, Transmembrane
Gene Summary 'Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C (see MIM 176960) regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as negative regulators of vesicle fusion, allowing fusion in the presence of calcium, and as calcium receptors or sensor molecules (summary by Hudson and Birnbaum, 1995 [PubMed 7597049]).[supplied by OMIM, Feb 2011]'
Transcript Variant: This variant (2) differs in the 5' UTR and contains multiple coding region differences, compared to variant 1. It encodes isoform 2, which is shorter and has a distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.