ACADM (NM_001286042) Human Untagged Clone

CAT#: SC335781

ACADM (untagged) - Human acyl-CoA dehydrogenase, C-4 to C-12 straight chain (ACADM), transcript variant 4


  "NM_001286042" in other vectors (1)

Reconstitution Protocol

USD 390.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "ACADM"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ACADM
Synonyms ACAD1; MCAD; MCADH
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286042, the custom clone sequence may differ by one or more nucleotides


ATGCTGCAGGAGTTCACCGAACAGCAGAAAGAATTTCAAGCTACTGCTCGTAAATTTGCCAGAGAGGAAA
TCATCCCAGTGGCTGCAGAATATGATAAAACTGGTGAATATCCAGTCCCCCTAATTAGAAGAGCCTGGGA
ACTTGGTTTAATGAACACACACATTCCAGAGAACTGTGGAGGTCTTGGACTTGGAACTTTTGATGCTTGT
TTAATTAGTGAAGAATTGGCTTATGGATGTACAGGGGTTCAGACTGCTATTGAAGGAAATTCTTTGGGGC
AAATGCCTATTATTATTGCTGGAAATGATCAACAAAAGAAGAAGTATTTGGGGAGAATGACTGAGGAGCC
ATTGATGTGTGCTTATTGTGTAACAGAACCTGGAGCAGGCTCTGATGTAGCTGGTATAAAGACCAAAGCA
GAAAAGAAAGGAGATGAGTATATTATTAATGGTCAGAAGATGTGGATAACCAACGGAGGAAAAGCTAATT
GGTATTTTTTATTGGCACGTTCTGATCCAGATCCTAAAGCTCCTGCTAATAAAGCCTTTACTGGATTCAT
TGTGGAAGCAGATACCCCAGGAATTCAGATTGGGAGAAAGGAATTAAACATGGGCCAGCGATGTTCAGAT
ACTAGAGGAATTGTCTTCGAAGATGTGAAAGTGCCTAAAGAAAATGTTTTAATTGGTGACGGAGCTGGTT
TCAAAGTTGCAATGGGAGCTTTTGATAAAACCAGACCTGTAGTAGCTGCTGGTGCTGTTGGATTAGCACA
AAGAGCTTTGGATGAAGCTACCAAGTATGCCCTGGAAAGGAAAACTTTCGGAAAGCTACTTGTAGAGCAC
CAAGCAATATCATTTATGCTGGCTGAAATGGCAATGAAAGTTGAACTAGCTAGAATGAGTTACCAGAGAG
CAGCTTGGGAGGTTGATTCTGGTCGTCGAAATACCTATTATGCTTCTATTGCAAAGGCATTTGCTGGAGA
TATTGCAAATCAGTTAGCTACTGATGCTGTGCAGATACTTGGAGGCAATGGATTTAATACAGAATATCCT
GTAGAAAAACTAATGAGGGATGCCAAAATCTATCAGATTTATGAAGGTACTTCACAAATTCAAAGACTTA
TTGTAGCCCGTGAACACATTGACAAGTACAAAAATTAA


Restriction Sites SgfI-MluI     
ACCN NM_001286042
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286042.1, NP_001272971.1
RefSeq Size 2535 bp
RefSeq ORF 1158 bp
Locus ID 34
Cytogenetics 1p31.1
Protein Families Druggable Genome
Protein Pathways beta-Alanine metabolism, Fatty acid metabolism, Metabolic pathways, PPAR signaling pathway, Propanoate metabolism, Valine, leucine and isoleucine degradation
Gene Summary 'This gene encodes the medium-chain specific (C4 to C12 straight chain) acyl-Coenzyme A dehydrogenase. The homotetramer enzyme catalyzes the initial step of the mitochondrial fatty acid beta-oxidation pathway. Defects in this gene cause medium-chain acyl-CoA dehydrogenase deficiency, a disease characterized by hepatic dysfunction, fasting hypoglycemia, and encephalopathy, which can result in infantile death. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (4) differs in the 5' UTR and lacks an exon in the 5' coding region. These difference cause translation initiation at an alternate start codon compared to variant 1. The encoded isoform (c) is shorter and has a distinct N-terminus compared to isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.