ZNF2 (NM_001282398) Human Untagged Clone

CAT#: SC335797

ZNF2 (untagged) - Human zinc finger protein 2 (ZNF2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZNF2
• Synonyms: A1-5; Zfp661; ZNF661
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282398, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGCTGTGTCTCCGACCACCAGATGCCAGGAATCAGTGACATTCGAAGACGTTGCCGTGGTTTTCA
  CAGATGAAGAGTGGAGTCGTCTGGTCCCCATACAGAGGGACCTCTACAAGGAGGTGATGCTGGAGAACTA
  TAACAGCATTGTGTCATTGGACTGGGAAACTAAGCCTGAGATTCACGATGCTTCAGACAAAAAATCAGAA
  GGATCATTGAGGGAATGCCTTGGAAGGCAAAGTCCTCTGTGTCCTAAATTTGAAGTTCATACACCCAATG
  GCAGGATGGGAACAGAAAAGCAAAGCCCTTCAGGGGAGACTCGTAAGAAATCCCTCTCCCGGGACAAAGG
  CTTGCGGCGACGGTCAGCCCTGTCCAGGGAAATTCTCACTAAAGAGAGACACCAGGAATGCAGTGACTGT
  GGGAAGACCTTTTTTGACCACTCATCCCTCACCCGCCATCAGAGGACTCACACTGGGGAGAAGCCCTACG
  ACTGCCGCGAGTGTGGGAAAGCCTTCAGCCACAGGAGCAGCCTCAGCAGACATCTGATGTCACACACTGG
  GGAGAGCCCCTACGAGTGCAGTGTGTGCTCAAAAGCCTTCTTTGACCGTTCGTCCCTAACTGTCCATCAG
  CGAATTCACACTGGAGAGAAACCCTTTCAGTGCAACGAGTGTGGAAAAGCCTTTTTTGACCGTTCATCCC
  TTACTCGACACCAGAGAATTCACACTGGAGAAAGTCCTTATGAATGTCATCAGTGTGGGAAAGCCTTTAG
  CCAGAAAAGTATTCTTACTCGCCATCAGCTAATCCACACTGGCAGGAAGCCTTATGAGTGTAACGAGTGC
  GGGAAAGCTTTCTATGGTGTCTCGTCTCTGAATAGACATCAGAAAGCTCATGCTGGGGACCCTCGCTATC
  AGTGTAACGAGTGTGGCAAAGCTTTCTTTGACCGCTCATCCCTTACACAGCATCAGAAGATCCACACTGG
  AGACAAGCCATATGAATGCAGCGAATGCGGGAAAGCCTTTAGCCAGCGGTGCCGGCTCACGCGGCATCAG
  CGTGTCCACACGGGAGAGAAGCCCTTTGAATGCACTGTGTGTGGGAAAGTTTTCAGTTCAAAATCTTCTG
  TTATTCAACATCAACGGCGTTACGCCAAACAGGGAATAGACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282398
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282398.1, NP_001269327.1
• RefSeq Size: 3866 bp
• RefSeq ORF: 1164 bp
• Locus ID: 7549
• Cytogenetics: 2q11.1
• Protein Families: Transcription Factors
• Gene Summary: 'The protein encoded by this gene belongs to the C2H2-type zinc-finger protein family. The exact function of this gene is not known, however, zinc-finger proteins are known to interact with DNA and function as transcription regulators. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]'
  Transcript Variant: This variant (3) lacks an alternate in-frame exon, compared to variant 1. The encoded isoform (c) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to remove an internal 3-nt sequence that was removed in the update of the GRCh37 reference genome assembly to the GRCh38 assembly. The update results in a protein that is 1 aa shorter.