CTNNA3 (NM_001291133) Human Untagged Clone

CAT#: SC335805

CTNNA3 (untagged) - Human catenin (cadherin-associated protein), alpha 3 (CTNNA3), transcript variant 3


  "NM_001291133" in other vectors (1)

Reconstitution Protocol

USD 390.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "CTNNA3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CTNNA3
Synonyms ARVD13; VR22
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001291133, the custom clone sequence may differ by one or more nucleotides


ATGAAATCAACGCAAAGGAGAGAGAAACAAGGCAGCATGTCAGCTGAAACACCAATCACATTGAATATCG
ATCCTCAGGATCTGCAGGTCCAAACATTCACCGTGGAGAAGCTACTGGAGCCTCTCATAATCCAGGTTAC
CACACTTGTAAACTGTCCCCAGAACCCTTCCAGCAGGAAAAAAGGACGTTCGAAAAGAGCCAGTGTCCTT
CTAGCTTCTGTGGAGGAAGCAACTTGGAATTTATTAGACAAGGGAGAGAAGATTGCCCAGGAAGCTACAG
TTTTAAAGGATGAGCTTACGGCTTCACTTGAGGAAGTTCGCAAAGAAAGTGAAGCTCTGAAAGTATCAGC
TGAGAGATTTACAGATGACCCCTGTTTTCTCCCAAAAAGGGAGGCTGTGGTTCAAGCTGCCCGTGCCTTG
CTGGCTGCGGTGACGAGACTCCTTATCCTTGCGGACATGATTGATGTCATGTGCCTCTTGCAACATGTGT
CAGCTTTTCAAAGGACATTTGAGTCTCTCAAAAATGTTGCCAACAAATCTGACCTCCAGAAAACCTACCA
GAAGCTTGGGAAGGAGCTGGAAAATTTGGATTATTTAGCCTTCAAACGTCAGCAGGACTTAAAATCTCCA
AATCAGAGAGATGAAATTGCAGGAGCCCGAGCTTCACTGAAGGAGAACTCTCCCCTCTTGCATTCAATTT
GTTCAGCTTGTTTGGAGCATTCTGATGTTGCTTCCCTCAAAGCAAGCAAGGACACAGTTTGTGAAGAAAT
TCAGAATGCTCTCAATGTAATTTCAAATGCTTCACAAGGGATCCAGAATATGACAACCCCACCAGAACCT
CAGGCAGCAACCCTGGGAAGTGCCCTTGATGAGCTGGAGAATTTAATTGTCCTGAATCCACTCACAGTAA
CTGAGGAGGAAATACGACCATCACTAGAGAAACGCCTTGAAGCCATTATCAGTGGGGCTGCTCTGCTGGC
GGATTCTTCATGTACGAGGGACTTACACCGAGAGCGGATTATCGCAGAATGCAACGCCATTCGCCAGGCT
CTTCAGGATCTGCTTTCAGAGTACATGAACAACCTCTGTAATCAAAAGTCTGACCTGGGCCTCACTGGAG
TAAAAATCAAATTGTTGGAGGAATGCATTATTTTCTGGAGTCTCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001291133
ORF Size 1167 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001291133.1, NP_001278062.1
RefSeq Size 2790
RefSeq ORF 1167
Locus ID 29119
Protein Pathways Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Endometrial cancer, Leukocyte transendothelial migration, Pathways in cancer, Tight junction
Gene Summary This gene encodes a protein that belongs to the vinculin/alpha-catenin family. The encoded protein plays a role in cell-cell adhesion in muscle cells. Mutations in this gene are associated with arrhythmogenic right ventricular dysplasia, familial 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (3) has multiple differences compared to variant 1. These differences result in distinct 5' and 3' UTRs and cause translation initiation at an alternate start codon compared to variant 1. The encoded protein (isoform b) has a longer N-terminus, a distinct C-terminus, and is shorter compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. The intron between the last two exons of the source sequence is in a repeat-rich region and appears to be an artifact. This intron was replaced by genomic sequence to merge the two exons into one long exon.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.