VRK2 (NM_001288839) Human Untagged Clone

CAT#: SC335810

VRK2 (untagged) - Human vaccinia related kinase 2 (VRK2), transcript variant 7


  "NM_001288839" in other vectors (1)

Reconstitution Protocol

USD 390.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "VRK2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol VRK2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001288839, the custom clone sequence may differ by one or more nucleotides


ATGGTAATGGAAAGACTAGGAATAGATTTACAGAAGATCTCAGGCCAGAATGGTACCTTTAAAAAGTCAA
CTGTCCTGCAATTAGGTATCCGAATGTTGGATGTACTGGAATATATACATGAAAATGAATATGTTCATGG
TGATATAAAAGCAGCAAATCTACTTTTGGGTTACAAAAATCCAGACCAGGTTTATCTTGCAGATTATGGA
CTTTCCTACAGATATTGTCCCAATGGGAACCACAAACAGTATCAGGAAAATCCTAGAAAAGGCCATAATG
GGACAATAGAGTTTACCAGCTTGGATGCCCACAAGGGAGTAGCCTTGTCCAGACGAAGTGACGTTGAGAT
CCTCGGCTACTGCATGCTGCGGTGGTTGTGTGGGAAACTTCCCTGGGAACAGAACCTGAAGGACCCTGTG
GCTGTGCAGACTGCTAAAACAAATCTGTTGGACGAGCTCCCCCAGTCAGTGCTTAAATGGGCTCCTTCTG
GAAGCAGTTGCTGTGAAATAGCCCAATTTTTGGTATGTGCTCATAGTTTAGCATATGATGAAAAGCCAAA
CTATCAAGCCCTCAAGAAAATTTTGAACCCTCATGGAATACCTTTAGGACCACTGGACTTTTCCACAAAA
GGACAGAGTATAAATGTCCATACTCCAAACAGTCAAAAAGTTGATTCACAAAAGGCTGCAACAAAGCAAG
TCAACAAGGCACACAATAGGTTAATCGAAAAAAAAGTCCACAGTGAGAGAAGCGCTGAGTCCTGTGCAAC
ATGGAAAGTGCAGAAAGAGGAGAAACTGATTGGATTGATGAACAATGAAGCAGCTCAGGAAAGCACAAGG
AGAAGACAGAAATATCAAGAGTCTCAAGAACCTTTGAATGAAGTAAACAGTTTCCCACAAAAAATCAGCT
ATACACAATTCCCAAACTCATTTTATGAGCCTCATCAAGATTTTACCAGTCCAGATATATTCAAGAAGTC
AAGATCTCCATCTTGGTATAAATACACTTCCACAGTCAGCACGGGGATCACAGACTTAGAAAGTTCAACT
GGACTTTGGCCTACAATTTCCCAGTTTACTCTTAGTGAAGAGACAAACGCAGATGTTTATTATTATCGCA
TCATCATACCTGTCCTTTTGATGTTAGTATTTCTTGCTTTATTTTTTCTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001288839
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001288839.1, NP_001275768.1
RefSeq Size 1916 bp
RefSeq ORF 1173 bp
Locus ID 7444
Cytogenetics 2p16.1
Protein Families Druggable Genome, Protein Kinase, Transmembrane
Gene Summary 'This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. The encoded protein acts as an effector of signaling pathways that regulate apoptosis and tumor cell growth. Variants in this gene have been associated with schizophrenia. Alternative splicing results in multiple transcript variants that differ in their subcellular localization and biological activity. [provided by RefSeq, Jan 2014]'
Transcript Variant: This variant (7) lacks an exon in the 5' region, compared to variant 1, and initiates translation at a downstream in-frame start codon. The encoded isoform (4) has a shorter N-terminus than isoform 1. Variants 6 and 7 encode the same isoform (4). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.