VRK2 (NM_001288838) Human Untagged Clone
CAT#: SC335849
VRK2 (untagged) - Human vaccinia related kinase 2 (VRK2), transcript variant 9
"NM_001288838" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | VRK2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001288838, the custom clone sequence may differ by one or more nucleotides
ATGCCACCAAAAAGAAATGAAAAATACAAACTTCCTATTCCATTTCCAGAAGGCAAGGTTCTGGATGATA TGGAAGGCAATCAGTGGGTACTGGGCAAGAAGATTGGCTCTGGAGGATTTGGATTGATATATTTAGCTTT CCCCACAAATAAACCAGAGAAAGATGCAAGACATGTAGTAAAAGTGGAATATCAAGAAAATGGCCCGTTA TTTTCAGAACTTAAATTTTATCAGAGAGTTGCAAAAAAAGACTGTATCAAAAAGTGGATAGAACGCAAAC AACTTGATTATTTAGGAATTCCTCTGTTTTATGGATCTGGTCTGACTGAATTCAAGGGAAGAAGTTACAG ATTTATGGTAATGGAAAGACTAGGAATAGATTTACAGAAGATCTCAGGCCAGAATGGTACCTTTAAAAAG TCAACTGTCCTGCAATTAGGTATCCGAATGTTGGATGTACTGGAATATATACATGAAAATGAATATGTTC ATGGTGATATAAAAGCAGCAAATCTACTTTTGGGTTACAAAAATCCAGACCAGGTTTATCTTGCAGATTA TGGACTTTCCTACAGATATTGTCCCAATGGGAACCACAAACAGTATCAGGAAAATCCTAGAAAAGGCCAT AATGGGACAATAGAGTTTACCAGCTTGGATGCCCACAAGGGAGTAGCCTTGTCCAGACGAAGTGACGTTG AGATCCTCGGCTACTGCATGCTGCGGTGGTTGTGTGGGAAACTTCCCTGGGAACAGAACCTGAAGGACCC TGTGGCTGTGCAGACTGCTAAAACAAATCTGTTGGACGAGCTCCCCCAGTCAGTGCTTAAATGGGCTCCT TCTGGAAGCAGTTGCTGTGAAATAGCCCAATTTTTGGTATGTGCTCATAGTTTAGCATATGATGAAAAGC CAAACTATCAAGCCCTCAAGAAAATTTTGAACCCTCATGGAATACCTTTAGGACCACTGGACTTTTCCAC AAAAGGACAGAGTATAAATGTCCATACTCCAAACAGTCAAAAAGTTGATTCACAAAAGGCTGCAACAAAG CAAGTCAACAAGGCACACAATAGGTTAATCGAAAAAAAAGTCCACAGTGAGAGAAGCGCTGAGTCCTGTG CAACATGGAAAGTGCAGAAAGAGGAGAAACTGATTGGATTGATGAACAATGAAGCAGCTCAGTTTAGGTA G |
Restriction Sites | SgfI-MluI |
ACCN | NM_001288838 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001288838.1, NP_001275767.1 |
RefSeq Size | 2430 bp |
RefSeq ORF | 1191 bp |
Locus ID | 7444 |
Cytogenetics | 2p16.1 |
Protein Families | Druggable Genome, Protein Kinase, Transmembrane |
Gene Summary | 'This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. The encoded protein acts as an effector of signaling pathways that regulate apoptosis and tumor cell growth. Variants in this gene have been associated with schizophrenia. Alternative splicing results in multiple transcript variants that differ in their subcellular localization and biological activity. [provided by RefSeq, Jan 2014]' Transcript Variant: This variant (9) represents use of an alternate upstream promoter, differs in the 5' UTR, and contains an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (3) has a shorter and distinct C-terminus, compared to isoform 1. Variants 5 and 9 encode the same isoform (3, also known as VRK2B). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237955 | VRK2 (myc-DDK-tagged) - Human vaccinia related kinase 2 (VRK2), transcript variant 9 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review