SLC2A2 (NM_001278658) Human Untagged Clone

CAT#: SC335912

SLC2A2 (untagged) - Human solute carrier family 2 (facilitated glucose transporter), member 2 (SLC2A2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC2A2
• Synonyms: GLUT2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001278658, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCACCTCAACAGAATCAAAGCCATGTTAGTAGCAAACATTCTGTCATTAGTTGGAGCTCTCTTGATGG
  GGTTTTCAAAATTGGGACCATCTCATATACTTATAATTGCTGGAAGAAGCATATCAGGACTATATTGTGG
  GCTAATTTCAGGCCTGGTTCCTATGTATATCGGTGAAATTGCTCCAACCGCTCTCAGGGGAGCACTTGGC
  ACTTTTCATCAGCTGGCCATCGTCACGGGCATTCTTATTAGTCAGATTATTGGTCTTGAATTTATCTTGG
  GCAATTATGATCTGTGGCACATCCTGCTTGGCCTGTCTGGTGTGCGAGCCATCCTTCAGTCTCTGCTACT
  CTTTTTCTGTCCAGAAAGCCCCAGATACCTTTACATCAAGTTAGATGAGGAAGTCAAAGCAAAACAAAGC
  TTGAAAAGACTCAGAGGATATGATGATGTCACCAAAGATATTAATGAAATGAGAAAAGAAAGAGAAGAAG
  CATCGAGTGAGCAGAAAGTCTCTATAATTCAGCTCTTCACCAATTCCAGCTACCGACAGCCTATTCTAGT
  GGCACTGATGCTGCATGTGGCTCAGCAATTTTCCGGAATCAATGGCATTTTTTACTACTCAACCAGCATT
  TTTCAGACGGCTGGTATCAGCAAACCTGTTTATGCAACCATTGGAGTTGGCGCTGTAAACATGGTTTTCA
  CTGCTGTCTCTGTATTCCTTGTGGAGAAGGCAGGGCGACGTTCTCTCTTTCTAATTGGAATGAGTGGGAT
  GTTTGTTTGTGCCATCTTCATGTCAGTGGGACTTGTGCTGCTGAATAAGTTCTCTTGGATGAGTTATGTG
  AGCATGATAGCCATCTTCCTCTTTGTCAGCTTCTTTGAAATTGGGCCAGGCCCGATCCCCTGGTTCATGG
  TGGCTGAGTTTTTCAGTCAAGGACCACGTCCTGCTGCTTTAGCAATAGCTGCATTCAGCAATTGGACCTG
  CAATTTCATTGTAGCTCTGTGTTTCCAGTACATTGCGGACTTCTGTGGACCTTATGTGTTTTTCCTCTTT
  GCTGGAGTGCTCCTGGCCTTTACCCTGTTCACATTTTTTAAAGTTCCAGAAACCAAAGGAAAGTCTTTTG
  AGGAAATTGCTGCAGAATTCCAAAAGAAGAGTGGCTCAGCCCACAGGCCAAAAGCTGCTGTAGAAATGAA
  ATTCCTAGGAGCTACAGAGACTGTGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278658
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278658.1, NP_001265587.1
• RefSeq Size: 3176 bp
• RefSeq ORF: 1218 bp
• Locus ID: 6514
• Cytogenetics: 3q26.2
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
• Protein Pathways: Maturity onset diabetes of the young, Type II diabetes mellitus
• Gene Summary: 'This gene encodes an integral plasma membrane glycoprotein of the liver, islet beta cells, intestine, and kidney epithelium. The encoded protein mediates facilitated bidirectional glucose transport. Because of its low affinity for glucose, it has been suggested as a glucose sensor. Mutations in this gene are associated with susceptibility to diseases, including Fanconi-Bickel syndrome and noninsulin-dependent diabetes mellitus (NIDDM). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]'
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks an alternate exon in the 5' coding region and initiates translation at an alternate start codon, compared to variant 1. It encodes isoform 2 which is shorter and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments and experimental data in the literature (PMID: 11978637).