SSB (NM_001294145) Human Untagged Clone

CAT#: SC335919

SSB (untagged) - Human Sjogren syndrome antigen B (autoantigen La) (SSB), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SSB
• Synonyms: La; La/SSB; LARP3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001294145, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGAAAATGGTGATAATGAAAAGATGGCTGCCCTGGAGGCCAAAATCTGTCATCAAATTGAGTATT
  ATTTTGGCGACTTCAATTTGCCACGGGACAAGTTTCTAAAGGAACAGATAAAACTGGATGAAGGCTGGGT
  ACCTTTGGAGATAATGATAAAATTCAACAGGTTGAACCGTCTAACAACAGACTTTAATGTAATTGTGGAA
  GCATTGAGCAAATCCAAGGCAGAACTCATGGAAATCAGTGAAGATAAAACTAAAATCAGAAGGTCTCCAA
  GCAAACCCCTACCTGAAGTGACTGATGAGTATAAAAATGATGTAAAAAACAGATCTGTTTATATTAAAGG
  CTTCCCAACTGATGCAACTCTTGATGACATAAAAGAATGGTTAGAAGATAAAGGTCAAGTACTAAATATT
  CAGATGAGAAGAACATTGCATAAAGCATTTAAGGGATCAATTTTTGTTGTGTTTGATAGCATTGAATCTG
  CTAAGAAATTTGTAGAGACCCCTGGCCAGAAGTACAAAGAAACAGACCTGCTAATACTTTTCAAGGACGA
  TTACTTTGCCAAAAAAAATGAAGAAAGAAAACAAAATAAAGTGGAAGCTAAATTAAGAGCTAAACAGGAG
  CAAGAAGCAAAACAAAAGTTAGAAGAAGATGCTGAAATGAAATCTCTAGAAGAAAAGATTGGATGCTTGC
  TGAAATTTTCGGGTGATTTAGATGATCAGACCTGTAGAGAAGATTTACACATACTTTTCTCAAATCATGG
  TGAAATAAAATGGATAGACTTCGTCAGAGGAGCAAAAGAGGGGATAATTCTATTTAAAGAAAAAGCCAAG
  GAAGCATTGGGTAAAGCCAAAGATGCAAATAATGGTAACCTACAATTAAGGAACAAAGAAGTGACTTGGG
  AAGTACTAGAAGGAGAGGTGGAAAAAGAAGCACTGAAGAAAATAATAGAAGACCAACAAGAATCCCTAAA
  CAAATGGAAGTCAAAAGGTCGTAGATTTAAAGGAAAAGGAAAGGGTAATAAAGCTGCCCAGCCTGGGTCT
  GGTAAAGGAAAAGTACAGTTTCAGGGCAAGAAAACGAAATTTGCTAGTGATGATGAACATGATGAACATG
  ATGAAAATGGTGCAACTGGACCTGTGAAAAGAGCAAGAGAAGAAACAGACAAAGAAGAACCTGCATCCAA
  ACAACAGAAAACAGAAAATGGTGCTGGAGACCAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001294145
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001294145.1, NP_001281074.1
• RefSeq Size: 2043 bp
• RefSeq ORF: 1227 bp
• Locus ID: 6741
• Cytogenetics: 2q31.1
• Protein Families: Stem cell - Pluripotency, Transcription Factors
• Protein Pathways: Systemic lupus erythematosus
• Gene Summary: 'The protein encoded by this gene is involved in diverse aspects of RNA metabolism, including binding and protecting poly(U) termini of nascent RNA polymerase III transcripts from exonuclease digestion, processing 5' and 3' ends of pre-tRNA precursors, acting as an RNA chaperone, and binding viral RNAs associated with hepatitis C virus. Autoantibodies reacting with this protein are found in the sera of patients with Sjogren syndrome and systemic lupus erythematosus. Alternative promoter usage results in two different transcript variants which encode the same protein. [provided by RefSeq, Jun 2014]'
  Transcript Variant: This variant (2) has an alternate 5' UTR exon and encodes the same protein, compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.