Adenosine Receptor A2a (ADORA2A) (NM_001278499) Human Untagged Clone
CAT#: SC335959
ADORA2A (untagged) - Human adenosine A2a receptor (ADORA2A), transcript variant 4
"NM_001278499" in other vectors (1)
Product Images
![](https://origeneresource2.s3.us-east-2.amazonaws.com/cmsstatics/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ADORA2A |
Synonyms | A2aR; ADORA2; RDC8 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001278499, the custom clone sequence may differ by one or more nucleotides
ATGCCCATCATGGGCTCCTCGGTGTACATCACGGTGGAGCTGGCCATTGCTGTGCTGGCCATCCTGGGCA ATGTGCTGGTGTGCTGGGCCGTGTGGCTCAACAGCAACCTGCAGAACGTCACCAACTACTTTGTGGTGTC ACTGGCGGCGGCCGACATCGCAGTGGGTGTGCTCGCCATCCCCTTTGCCATCACCATCAGCACCGGGTTC TGCGCTGCCTGCCACGGCTGCCTCTTCATTGCCTGCTTCGTCCTGGTCCTCACGCAGAGCTCCATCTTCA GTCTCCTGGCCATCGCCATTGACCGCTACATTGCCATCCGCATCCCGCTCCGGTACAATGGCTTGGTGAC CGGCACGAGGGCTAAGGGCATCATTGCCATCTGCTGGGTGCTGTCGTTTGCCATCGGCCTGACTCCCATG CTAGGTTGGAACAACTGCGGTCAGCCAAAGGAGGGCAAGAACCACTCCCAGGGCTGCGGGGAGGGCCAAG TGGCCTGTCTCTTTGAGGATGTGGTCCCCATGAACTACATGGTGTACTTCAACTTCTTTGCCTGTGTGCT GGTGCCCCTGCTGCTCATGCTGGGTGTCTATTTGCGGATCTTCCTGGCGGCGCGACGACAGCTGAAGCAG ATGGAGAGCCAGCCTCTGCCGGGGGAGCGGGCACGGTCCACACTGCAGAAGGAGGTCCATGCTGCCAAGT CACTGGCCATCATTGTGGGGCTCTTTGCCCTCTGCTGGCTGCCCCTACACATCATCAACTGCTTCACTTT CTTCTGCCCCGACTGCAGCCACGCCCCTCTCTGGCTCATGTACCTGGCCATCGTCCTCTCCCACACCAAT TCGGTTGTGAATCCCTTCATCTACGCCTACCGTATCCGCGAGTTCCGCCAGACCTTCCGCAAGATCATTC GCAGCCACGTCCTGAGGCAGCAAGAACCTTTCAAGGCAGCTGGCACCAGTGCCCGGGTCTTGGCAGCTCA TGGCAGTGACGGAGAGCAGGTCAGCCTCCGTCTCAACGGCCACCCGCCAGGAGTGTGGGCCAACGGCAGT GCTCCCCACCCTGAGCGGAGGCCCAATGGCTATGCCCTGGGGCTGGTGAGTGGAGGGAGTGCCCAAGAGT CCCAGGGGAACACGGGCCTCCCAGACGTGGAGCTCCTTAGCCATGAGCTCAAGGGAGTGTGCCCAGAGCC CCCTGGCCTAGATGACCCCCTGGCCCAGGATGGAGCAGGAGTGTCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278499 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001278499.1, NP_001265428.1 |
RefSeq Size | 2563 bp |
RefSeq ORF | 1239 bp |
Locus ID | 135 |
Cytogenetics | 22q11.23 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Calcium signaling pathway, Neuroactive ligand-receptor interaction, Vascular smooth muscle contraction |
Gene Summary | 'This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]' Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants, 1, 2, 3, 4, and 5 encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC238065 | ADORA2A (myc-DDK-tagged) - Human adenosine A2a receptor (ADORA2A), transcript variant 4 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review