KIR5.1 (KCNJ16) (NM_001291624) Human Untagged Clone
CAT#: SC336001
KCNJ16 (untagged) - Human potassium inwardly-rectifying channel, subfamily J, member 16 (KCNJ16), transcript variant 7
"NM_001291624" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KCNJ16 |
Synonyms | BIR9; KIR5.1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001291624, the custom clone sequence may differ by one or more nucleotides
ATGAGCTATTACGGCAGCAGCTATCATATTATCAATGCGGACGCAAAATACCCAGGCTACCCGCCAGAGC ACATTATAGCTGAGAAGAGAAGAGCAAGAAGACGATTACTTCACAAAGATGGCAGCTGTAATGTCTACTT CAAGCACATTTTTGGAGAATGGGGAAGCTATGTGGTTGACATCTTCACCACTCTTGTGGACACCAAGTGG CGCCATATGTTTGTGATATTTTCTTTATCTTATATTCTCTCGTGGTTGATATTTGGCTCTGTCTTTTGGC TCATAGCCTTTCATCATGGCGATCTATTAAATGATCCAGACATCACACCTTGTGTTGACAACGTCCATTC TTTCACAGGGGCCTTTTTGTTCTCCCTAGAGACCCAAACCACCATAGGATATGGTTATCGCTGTGTTACT GAAGAATGTTCTGTGGCCGTGCTCATGGTGATCCTCCAGTCCATCTTAAGTTGCATCATAAATACCTTTA TCATTGGAGCTGCCTTGGCCAAAATGGCAACTGCTCGAAAGAGAGCCCAAACCATTCGTTTCAGCTACTT TGCACTTATAGGTATGAGAGATGGGAAGCTTTGCCTCATGTGGCGCATTGGTGATTTTCGGCCAAACCAC GTGGTAGAAGGAACAGTTAGAGCCCAACTTCTCCGCTATACAGAAGACAGTGAAGGGAGGATGACGATGG CATTTAAAGACCTCAAATTAGTCAACGACCAAATCATCCTGGTCACCCCGGTAACTATTGTCCATGAAAT TGACCATGAGAGCCCTCTGTATGCCCTTGACCGCAAAGCAGTAGCCAAAGATAACTTTGAGATTTTGGTG ACATTTATCTATACTGGTGATTCCACTGGAACATCTCACCAATCTAGAAGCTCCTATGTTCCCCGAGAAA TTCTCTGGGGCCATAGGTTTAATGATGTCTTGGAAGTTAAGAGGAAGTATTACAAAGTGAACTGCTTACA GTTTGAAGGAAGTGTGGAAGTATATGCCCCCTTTTGCAGTGCCAAGCAATTGGACTGGAAAGACCAGCAG CTCCACATAGAAAAAGCACCACCAGTTCGAGAATCCTGCACGTCGGACACCAAGGCGAGACGAAGGTCAT TTAGTGCAGTTGCCATTGTCAGCAGCTGTGAAAACCCTGAGGAGACCACCACTTCCGCCACACATGAATA TAGGGAAACACCTTATCAGAAAGCTCTCCTGACTTTAAACAGAATCTCTGTAGAATCCCAAATGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291624 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001291624.1, NP_001278553.1 |
RefSeq Size | 4084 bp |
RefSeq ORF | 1257 bp |
Locus ID | 3773 |
Cytogenetics | 17q24.3 |
Protein Families | Druggable Genome, Ion Channels: Potassium, Transmembrane |
Gene Summary | 'Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which tends to allow potassium to flow into rather than out of a cell, can form heterodimers with two other inward-rectifier type potassium channels. It may function in fluid and pH balance regulation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2014]' Transcript Variant: This variant (7) differs in the 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to variant a. Variants 4, 7 and 8 all encode isoform b. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC238107 | KCNJ16 (myc-DDK-tagged) - Human potassium inwardly-rectifying channel, subfamily J, member 16 (KCNJ16), transcript variant 7 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review