KIR5.1 (KCNJ16) (NM_001291624) Human Untagged Clone

CAT#: SC336001

KCNJ16 (untagged) - Human potassium inwardly-rectifying channel, subfamily J, member 16 (KCNJ16), transcript variant 7


  "NM_001291624" in other vectors (1)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNJ16"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCNJ16
Synonyms BIR9; KIR5.1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001291624, the custom clone sequence may differ by one or more nucleotides


ATGAGCTATTACGGCAGCAGCTATCATATTATCAATGCGGACGCAAAATACCCAGGCTACCCGCCAGAGC
ACATTATAGCTGAGAAGAGAAGAGCAAGAAGACGATTACTTCACAAAGATGGCAGCTGTAATGTCTACTT
CAAGCACATTTTTGGAGAATGGGGAAGCTATGTGGTTGACATCTTCACCACTCTTGTGGACACCAAGTGG
CGCCATATGTTTGTGATATTTTCTTTATCTTATATTCTCTCGTGGTTGATATTTGGCTCTGTCTTTTGGC
TCATAGCCTTTCATCATGGCGATCTATTAAATGATCCAGACATCACACCTTGTGTTGACAACGTCCATTC
TTTCACAGGGGCCTTTTTGTTCTCCCTAGAGACCCAAACCACCATAGGATATGGTTATCGCTGTGTTACT
GAAGAATGTTCTGTGGCCGTGCTCATGGTGATCCTCCAGTCCATCTTAAGTTGCATCATAAATACCTTTA
TCATTGGAGCTGCCTTGGCCAAAATGGCAACTGCTCGAAAGAGAGCCCAAACCATTCGTTTCAGCTACTT
TGCACTTATAGGTATGAGAGATGGGAAGCTTTGCCTCATGTGGCGCATTGGTGATTTTCGGCCAAACCAC
GTGGTAGAAGGAACAGTTAGAGCCCAACTTCTCCGCTATACAGAAGACAGTGAAGGGAGGATGACGATGG
CATTTAAAGACCTCAAATTAGTCAACGACCAAATCATCCTGGTCACCCCGGTAACTATTGTCCATGAAAT
TGACCATGAGAGCCCTCTGTATGCCCTTGACCGCAAAGCAGTAGCCAAAGATAACTTTGAGATTTTGGTG
ACATTTATCTATACTGGTGATTCCACTGGAACATCTCACCAATCTAGAAGCTCCTATGTTCCCCGAGAAA
TTCTCTGGGGCCATAGGTTTAATGATGTCTTGGAAGTTAAGAGGAAGTATTACAAAGTGAACTGCTTACA
GTTTGAAGGAAGTGTGGAAGTATATGCCCCCTTTTGCAGTGCCAAGCAATTGGACTGGAAAGACCAGCAG
CTCCACATAGAAAAAGCACCACCAGTTCGAGAATCCTGCACGTCGGACACCAAGGCGAGACGAAGGTCAT
TTAGTGCAGTTGCCATTGTCAGCAGCTGTGAAAACCCTGAGGAGACCACCACTTCCGCCACACATGAATA
TAGGGAAACACCTTATCAGAAAGCTCTCCTGACTTTAAACAGAATCTCTGTAGAATCCCAAATGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001291624
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291624.1, NP_001278553.1
RefSeq Size 4084 bp
RefSeq ORF 1257 bp
Locus ID 3773
Cytogenetics 17q24.3
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
Gene Summary 'Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which tends to allow potassium to flow into rather than out of a cell, can form heterodimers with two other inward-rectifier type potassium channels. It may function in fluid and pH balance regulation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2014]'
Transcript Variant: This variant (7) differs in the 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to variant a. Variants 4, 7 and 8 all encode isoform b.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.