DKC1 (NM_001288747) Human Untagged Clone

CAT#: SC336012

DKC1 (untagged) - Human dyskeratosis congenita 1, dyskerin (DKC1), transcript variant 3


  "NM_001288747" in other vectors (1)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "DKC1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DKC1
Synonyms CBF5; DKC; DKCX; NAP57; NOLA4; XAP101
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001288747, the custom clone sequence may differ by one or more nucleotides


ATGGCGGATGCGGAAGTAATTATTTTGCCAAAGAAACATAAGAAGAAAAAGGAGCGGAAGTCATTGCCAG
AAGAAGATGTAGCCGAAATACAACACGCTGAAGAATTTCTTATCAAACCTGAATCCAAAGTTGCTAAGTT
GGACACGTCTCAGTGGCCCCTTTTGCTAAAGAATTTTGATAAGCTGAATGTAAGGACAACACACTATACA
CCTCTTGCATGTGGTTCAAATCCTCTGAAGAGAGAGATTGGGGACTATATCAGGACAGGTTTCATTAATC
TTGACAAGCCCTCTAACCCCTCTTCCCATGAGGTGGTAGCCTGGATTCGACGGATACTTCGGGTGGAGAA
GACAGGGCACAGTGGTACTCTGGATCCCAAGGTGACTGGTTGTTTAATCGTGTGCATAGAACGAGCCACT
CGCTTGGTGAAGTCACAACAGAGTGCAGGCAAAGAGTATGTGGGGATTGTCCGGCTGCACAATGCTATTG
AAGGGGGGACCCAGCTTTCTAGGGCCCTAGAAACTCTGACAGGTGCCTTATTCCAGCGACCCCCACTTAT
TGCTGCAGTAAAGAGGCAGCTCCGAGTGAGGACCATCTACGAGAGCAAAATGATTGAATACGATCCTGAA
AGAAGATTAGGAATCTTTTGGGTGAGTTGTGAGGCTGGCACCTACATTCGGACATTATGTGTGCACCTTG
GTTTGTTATTGGGAGTTGGTGGTCAGATGCAGGAGCTTCGGAGGGTTCGTTCTGGAGTCATGAGTGAAAA
GGACCACATGGTGACAATGCATGATGTGCTTGATGCTCAGTGGCTGTATGATAACCACAAGGATGAGAGT
TACCTGCGGCGAGTTGTTTACCCTTTGGAAAAGCTGTTGACATCTCATAAACGGCTGGTTATGAAAGACA
GTGCAGTAAATGCCATCTGCTATGGGGCCAAGATTATGCTTCCAGGTGTTCTTCGATATGAGGACGGCAT
TGAGGTCAATCAGGAGATTGTGGTTATCACCACCAAAGGAGAAGCAATCTGCATGGCTATTGCATTAATG
ACCACAGCGGTCATCTCTACCTGCGACCATGGTATAGTAGCCAAGATCAAGAGAGTGATCATGGAGAGAG
ACACTTACCCTCGGAAGTGGGGTTTAGGTCCAAAGGCAAGTCAGAAGAAGCTGATGATCAAGCAGGGCCT
TCTGGACAAGCATGGGAAGCCCACAGACAGCACACCTGCCACCTGGAAGCAGGAGTATGTTGACTACAGG
TGA


Restriction Sites SgfI-MluI     
ACCN NM_001288747
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001288747.1, NP_001275676.1
RefSeq Size 3097 bp
RefSeq ORF 1263 bp
Locus ID 1736
Cytogenetics Xq28
Protein Families Druggable Genome
Gene Summary 'This gene functions in two distinct complexes. It plays an active role in telomerase stabilization and maintenance, as well as recognition of snoRNAs containing H/ACA sequences which provides stability during biogenesis and assembly into H/ACA small nucleolar RNA ribonucleoproteins (snoRNPs). This gene is highly conserved and widely expressed, and may play additional roles in nucleo-cytoplasmic shuttling, DNA damage response, and cell adhesion. Mutations have been associated with X-linked dyskeratosis congenita. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]'
Transcript Variant: This variant (3) uses an alternate 3' exon structure, which results in an early stop codon, compared to variant 1. The resulting protein (isoform 3) has a distinct C-terminus, compared to isoform 1 (PMID: 21820037).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.