MYH (MUTYH) (NM_001293196) Human Untagged Clone

CAT#: SC336072

MUTYH (untagged) - Human mutY homolog (MUTYH), transcript variant gamma4


  "NM_001293196" in other vectors (1)

Reconstitution Protocol

USD 430.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "MUTYH"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MUTYH
Synonyms MYH
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001293196, the custom clone sequence may differ by one or more nucleotides


ATGGACCTGGACAGGCGGGCATATGCTGTGTGGGTCTCAGAGGTCATGCTGCAGCAGACCCAGGTTGCCA
CTGTGATCAACTACTATACCGGATGGATGCAGAAGTGGCCTACACTGCAGGACCTGGCCAGTGCTTCCCT
GGAGGAGGTGAATCAACTCTGGGCTGGCCTGGGCTACTATTCTCGTGGCCGGCGGCTGCAGGAGGGAGCT
CGGAAGGTGGTAGAGGAGCTAGGGGGCCACATGCCACGTACAGCAGAGACCCTGCAGCAGCTCCTGCCTG
GCGTGGGGCGCTACACAGCTGGGGCCATTGCCTCTATCGCCTTTGGCCAGGCAACCGGTGTGGTGGATGG
CAACGTAGCACGGGTGCTGTGCCGTGTCCGAGCCATTGGTGCTGATCCCAGCAGCACCCTTGTTTCCCAG
CAGCTCTGGGGTCTAGCCCAGCAGCTGGTGGACCCAGCCCGGCCAGGAGATTTCAACCAAGCAGCCATGG
AGCTAGGGGCCACAGTGTGTACCCCACAGCGCCCACTGTGCAGCCAGTGCCCTGTGGAGAGCCTGTGCCG
GGCACGCCAGAGAGTGGAGCAGGAACAGCTCTTAGCCTCAGGGAGCCTGTCGGGCAGTCCTGACGTGGAG
GAGTGTGCTCCCAACACTGGACAGTGCCACCTGTGCCTGCCTCCCTCGGAGCCCTGGGACCAGACCCTGG
GAGTGGTCAACTTCCCCAGAAAGGCCAGCCGCAAGCCCCCCAGGGAGGAGAGCTCTGCCACCTGTGTTCT
GGAACAGCCTGGGGCCCTTGGGGCCCAAATTCTGCTGGTGCAGAGGCCCAACTCAGGTCTGCTGGCAGGA
CTGTGGGAGTTCCCGTCCGTGACCTGGGAGCCCTCAGAGCAGCTTCAGCGCAAGGCCCTGCTGCAGGAAC
TACAGCGTTGGGCTGGGCCCCTCCCAGCCACGCACCTCCGGCACCTTGGGGAGGTTGTCCACACCTTCTC
TCACATCAAGCTGACATATCAAGTATATGGGCTGGCCTTGGAAGGGCAGACCCCAGTGACCACCGTACCA
CCAGGTGCTCGCTGGCTGACGCAGGAGGAATTTCACACCGCAGCTGTTTCCACCGCCATGAAAAAGGTTT
TCCGTGTGTATCAGGGCCAACAGCCAGGGACCTGTATGGGTTCCAAAAGGTCCCAGGTGTCCTCTCCGTG
CAGTCGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTCTCACATCTCCACTGAT
GCACACAGCCTCAACAGTGCAGCCCAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001293196
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001293196.1, NP_001280125.1
RefSeq Size 1728 bp
RefSeq ORF 1290 bp
Locus ID 4595
Cytogenetics 1p34.1
Protein Families Druggable Genome, Stem cell - Pluripotency
Protein Pathways Base excision repair
Gene Summary 'This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. This gene product is thought to play a role in signaling apoptosis by the introduction of single-strand breaks following oxidative damage. Mutations in this gene result in heritable predisposition to colorectal cancer, termed MUTYH-associated polyposis (MAP). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2017]'
Transcript Variant: This variant (gamma4) contains a distinct 5' UTR, and uses an alternate splice site in the 5' region, which results in translation initiation at a downstream AUG start codon, compared to variant alpha5. The resulting isoform (8) has a shorter N-terminus, compared to isoform 5. Variants alpha4 and gamma4 encode the same isoform 8.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.