MYH (MUTYH) (NM_001293196) Human Untagged Clone
CAT#: SC336072
MUTYH (untagged) - Human mutY homolog (MUTYH), transcript variant gamma4
"NM_001293196" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MUTYH |
Synonyms | MYH |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001293196, the custom clone sequence may differ by one or more nucleotides
ATGGACCTGGACAGGCGGGCATATGCTGTGTGGGTCTCAGAGGTCATGCTGCAGCAGACCCAGGTTGCCA CTGTGATCAACTACTATACCGGATGGATGCAGAAGTGGCCTACACTGCAGGACCTGGCCAGTGCTTCCCT GGAGGAGGTGAATCAACTCTGGGCTGGCCTGGGCTACTATTCTCGTGGCCGGCGGCTGCAGGAGGGAGCT CGGAAGGTGGTAGAGGAGCTAGGGGGCCACATGCCACGTACAGCAGAGACCCTGCAGCAGCTCCTGCCTG GCGTGGGGCGCTACACAGCTGGGGCCATTGCCTCTATCGCCTTTGGCCAGGCAACCGGTGTGGTGGATGG CAACGTAGCACGGGTGCTGTGCCGTGTCCGAGCCATTGGTGCTGATCCCAGCAGCACCCTTGTTTCCCAG CAGCTCTGGGGTCTAGCCCAGCAGCTGGTGGACCCAGCCCGGCCAGGAGATTTCAACCAAGCAGCCATGG AGCTAGGGGCCACAGTGTGTACCCCACAGCGCCCACTGTGCAGCCAGTGCCCTGTGGAGAGCCTGTGCCG GGCACGCCAGAGAGTGGAGCAGGAACAGCTCTTAGCCTCAGGGAGCCTGTCGGGCAGTCCTGACGTGGAG GAGTGTGCTCCCAACACTGGACAGTGCCACCTGTGCCTGCCTCCCTCGGAGCCCTGGGACCAGACCCTGG GAGTGGTCAACTTCCCCAGAAAGGCCAGCCGCAAGCCCCCCAGGGAGGAGAGCTCTGCCACCTGTGTTCT GGAACAGCCTGGGGCCCTTGGGGCCCAAATTCTGCTGGTGCAGAGGCCCAACTCAGGTCTGCTGGCAGGA CTGTGGGAGTTCCCGTCCGTGACCTGGGAGCCCTCAGAGCAGCTTCAGCGCAAGGCCCTGCTGCAGGAAC TACAGCGTTGGGCTGGGCCCCTCCCAGCCACGCACCTCCGGCACCTTGGGGAGGTTGTCCACACCTTCTC TCACATCAAGCTGACATATCAAGTATATGGGCTGGCCTTGGAAGGGCAGACCCCAGTGACCACCGTACCA CCAGGTGCTCGCTGGCTGACGCAGGAGGAATTTCACACCGCAGCTGTTTCCACCGCCATGAAAAAGGTTT TCCGTGTGTATCAGGGCCAACAGCCAGGGACCTGTATGGGTTCCAAAAGGTCCCAGGTGTCCTCTCCGTG CAGTCGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTCTCACATCTCCACTGAT GCACACAGCCTCAACAGTGCAGCCCAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001293196 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001293196.1, NP_001280125.1 |
RefSeq Size | 1728 bp |
RefSeq ORF | 1290 bp |
Locus ID | 4595 |
Cytogenetics | 1p34.1 |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Protein Pathways | Base excision repair |
Gene Summary | 'This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. This gene product is thought to play a role in signaling apoptosis by the introduction of single-strand breaks following oxidative damage. Mutations in this gene result in heritable predisposition to colorectal cancer, termed MUTYH-associated polyposis (MAP). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2017]' Transcript Variant: This variant (gamma4) contains a distinct 5' UTR, and uses an alternate splice site in the 5' region, which results in translation initiation at a downstream AUG start codon, compared to variant alpha5. The resulting isoform (8) has a shorter N-terminus, compared to isoform 5. Variants alpha4 and gamma4 encode the same isoform 8. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC238178 | MUTYH (myc-DDK-tagged) - Human mutY homolog (MUTYH), transcript variant gamma4 |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review