CTBP2 (NM_001290215) Human Untagged Clone

CAT#: SC336165

CTBP2 (untagged) - Human C-terminal binding protein 2 (CTBP2), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CTBP2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001290215, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCCTTGTGGATAAGCACAAAGTCAAGAGACAGCGATTGGACAGAATTTGTGAAGGTATCCGCCCCC
  AGATCATGAACGGCCCCCTGCACCCCCGCCCCCTGGTGGCGCTGCTGGACGGCCGCGACTGCACTGTGGA
  GATGCCCATCCTGAAGGACCTGGCCACTGTGGCCTTCTGTGACGCGCAGTCGACGCAGGAAATCCACGAG
  AAGGTTCTAAACGAAGCCGTGGGCGCCATGATGTACCACACCATCACCCTCACCAGGGAGGACCTGGAGA
  AGTTCAAGGCCCTGAGAGTGATCGTGCGGATAGGCAGTGGCTATGACAACGTGGACATCAAGGCTGCCGG
  CGAGCTCGGAATTGCCGTGTGCAACATCCCGTCTGCAGCCGTGGAAGAGACAGCGGACTCTACCATCTGC
  CACATCCTCAACCTGTACCGGAGGAACACGTGGCTGTACCAGGCACTGCGGGAAGGCACGCGGGTTCAGA
  GCGTGGAGCAGATCCGCGAGGTGGCCTCGGGAGCGGCCCGCATCCGTGGGGAGACGCTGGGCCTCATTGG
  CTTTGGTCGCACGGGGCAGGCGGTTGCAGTTCGAGCCAAGGCCTTTGGATTCAGCGTCATATTTTATGAC
  CCCTACTTGCAGGATGGGATCGAGCGGTCCCTGGGCGTGCAGAGGGTCTACACCCTGCAGGATTTGCTGT
  ATCAGAGCGACTGCGTCTCCTTGCACTGCAATCTCAACGAACATAACCACCACCTCATCAATGACTTTAC
  CATAAAGCAGATGAGGCAGGGAGCATTCCTTGTGAACGCAGCCCGTGGCGGCCTGGTGGACGAGAAAGCC
  TTAGCACAAGCCCTCAAGGAGGGCAGGATACGAGGGGCAGCCCTCGACGTGCATGAGTCAGAGCCCTTCA
  GCTTTGCTCAGGGTCCGTTGAAAGATGCCCCGAATCTCATCTGCACTCCTCACACTGCCTGGTACAGTGA
  GCAGGCGTCACTGGAGATGAGGGAGGCAGCTGCCACCGAGATCCGCCGAGCCATCACAGGTCGCATCCCA
  GAAAGCTTAAGAAATTGTGTGAACAAGGAATTCTTTGTCACATCAGCGCCTTGGTCAGTAATAGACCAGC
  AAGCAATTCATCCTGAGCTCAATGGTGCCACATACAGATATCCGCCAGGCATCGTGGGTGTGGCTCCAGG
  AGGACTTCCTGCAGCCATGGAAGGGATCATCCCTGGAGGCATCCCAGTGACTCACAACCTCCCGACAGTG
  GCACATCCTTCCCAAGCGCCCTCTCCCAACCAGCCCACAAAACACGGGGACAATCGAGAGCACCCCAACG
  AGCAATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001290215
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001290215.1, NP_001277144.1
• RefSeq Size: 3393 bp
• RefSeq ORF: 1338 bp
• Locus ID: 1488
• Cytogenetics: 10q26.13
• Protein Families: Stem cell - Pluripotency, Stem cell relevant signaling - Wnt Signaling pathway
• Protein Pathways: Chronic myeloid leukemia, Notch signaling pathway, Pathways in cancer, Wnt signaling pathway
• Gene Summary: 'This gene produces alternative transcripts encoding two distinct proteins. One protein is a transcriptional repressor, while the other isoform is a major component of specialized synapses known as synaptic ribbons. Both proteins contain a NAD+ binding domain similar to NAD+-dependent 2-hydroxyacid dehydrogenases. A portion of the 3' untranslated region was used to map this gene to chromosome 21q21.3; however, it was noted that similar loci elsewhere in the genome are likely. Blast analysis shows that this gene is present on chromosome 10. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]'
  Transcript Variant: This variant (5) contains a distinct 5' UTR and 5' CDS, compared to variant 2. Variants 1, 3, 4, and 5-8 all encode the same isoform (1), which has a distinct N-terminus that is 540 aa shorter than the N-terminus of isoform 2. The protein is thought to bind to the C-terminus of the adenovirus E1A proteins. Studies in mice suggest that this protein is involved in transcriptional repression. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.